Cookie Chad Crypto Game Dog - Mix of Yorkshire Terrier, Poodle, Grey Wolf, St. Bernard, Labrador BK, Border Collie, German Shepard, Pitbull terrier and Husky
Cookie Chad
  • Purity 5%
  • Age 17 months
  • Racing Exp 18
  • Yorkshire Terrier 18%
  • Gold medal 1 Silver medal 1 Bronze medal 0
  • 5 races
  • Gen 0
Depressed & Snaillike

Achievements

Racer

Bio

Hey, Baby. I'm Cookie Chad. It doesn't matter to me which team I play for... I just like tail. My favorite chews are underwear and rawhide...the rawhide lasts longer. I hate squeaky toys...when I finally get one to stop making that awful sound, my human buys another!

Racing Stats

Ran 5 races
  • 1 1 0
 Best Time15.52 sec
No rank  RacingĀ *** Pts
40.0 % wins (2) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: CCCTGAGCATACTCATTATTAGACTCCACAGAC
C
C
C
T
G
A
G
C
A
T
A
C
T
C
A
T
T
A
T
T
A
G
A
C
T
C
C
A
C
A
G
A
C
Genes: LB6J7FFIN4I

Composition

Yorkshire Terrier
18%
Poodle
18%
Grey Wolf
9%
St. Bernard
9%
Labrador BK
9%
Border Collie
9%
German Shepard
9%
Pitbull terrier
9%
Husky
9%

Current Energy

Vitality +6 points
Lunar Effect -14 points

Traits Breakdown

Body Grey Wolf
Tail St. Bernard
Legs Labrador BK
Front Legs Border Collie
Head German Shepard
Ears Yorkshire Terrier
Snout Yorkshire Terrier
Mouth Poodle
Nose Pitbull terrier
Eyes Husky
Color Poodle

Parents

No Children

Photos

cryptocurrency doggy race online dog race results
Gift