Cookie Chad Crypto Game Dog - Mix of Yorkshire Terrier, Poodle, Grey Wolf, St. Bernard, Labrador BK, Border Collie, German Shepard, Pitbull terrier and Husky

Achievements

Racer
Cookie Chad
Hey, Baby. I'm Cookie Chad. It doesn't matter to me which team I play for... I just like tail. My favorite chews are underwear and rawhide...the rawhide lasts longer. I hate squeaky toys...when I finally get one to stop making that awful sound, my human buys another!
  • Purity 5%
  • Age 20 months
  • Racing Exp 10
  • Yorkshire Terrier 18%
  • 3 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

  • 1 0 0
3 races    Best Time15.77 sec
No rank  Racing *** Coins
33.3 % wins (1) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CCCTGAGCATACTCATTATTAGACTCCACAGAC
C
C
C
T
G
A
G
C
A
T
A
C
T
C
A
T
T
A
T
T
A
G
A
C
T
C
C
A
C
A
G
A
C
Genes: LB6J7FFIN4I

Composition

Yorkshire Terrier
18%
Poodle
18%
Grey Wolf
9%
St. Bernard
9%
Labrador BK
9%
Border Collie
9%
German Shepard
9%
Pitbull terrier
9%
Husky
9%

Current Energy

Vitality +6 points
Lunar Effect -6 points

Traits Breakdown

Body Grey Wolf
Tail St. Bernard
Legs Labrador BK
Front Legs Border Collie
Head German Shepard
Ears Yorkshire Terrier
Snout Yorkshire Terrier
Mouth Poodle
Nose Pitbull terrier
Eyes Husky
Color Poodle