Finnegan Fiona Cryptocurrency Dog - Mix of Beagle, Husky, Border Collie, Rottweiler, Golder Retriever, German Shepard, Grey Wolf and St. Bernard
Finnegan Fiona
  • Purity 4%
  • Age 15 months
  • Racing Exp 0
  • Beagle 18%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 0
Depressed & Snaillike

Achievements

None

Bio

How's it going? I'm Finnegan Fiona. Size matters. This dawg's into big databases. My favorite chews are underwear and rawhide...the rawhide lasts longer. I'm not into dog collars, unless you're into S & M. If you are looking for companionship without commitment, keep looking.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: CACCTAACAAGATCACCCTACTGACTAACATAC
C
A
C
C
T
A
A
C
A
A
G
A
T
C
A
C
C
C
T
A
C
T
G
A
C
T
A
A
C
A
T
A
C
Genes: HD487LJBD4J

Composition

Beagle
18%
Husky
18%
Border Collie
18%
Rottweiler
9%
Golder Retriever
9%
German Shepard
9%
Grey Wolf
9%
St. Bernard
9%

Current Energy

Vitality -16 points
Lunar Effect -8 points

Traits Breakdown

Body Rottweiler
Tail Beagle
Legs Husky
Front Legs Golder Retriever
Head German Shepard
Ears Grey Wolf
Snout Border Collie
Mouth St. Bernard
Nose Beagle
Eyes Husky
Color Border Collie

Parents

No Children

Gift