Finnegan Fiona Cryptocurrency Dog - Mix of Beagle, Husky, Border Collie, Rottweiler, Golder Retriever, German Shepard, Grey Wolf and St. Bernard

Achievements

Racer
Finnegan Fiona
How's it going? I'm Finnegan Fiona. Size matters. This dawg's into big databases. My favorite chews are underwear and rawhide...the rawhide lasts longer. I'm not into dog collars, unless you're into S & M. If you are looking for companionship without commitment, keep looking.
  • Purity 4%
  • Age 23 months
  • Racing Exp 18
  • Beagle 18%
  • 6 races
  • Gen 0
Make him happy share it to your friend*
Sad & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

6 races   |
  • 1 0 1
 Best Time16.10 sec
Rank 84  Racing *** Coins
33.3 % wins (2) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CACCTAACAAGATCACCCTACTGACTAACATAC
C
A
C
C
T
A
A
C
A
A
G
A
T
C
A
C
C
C
T
A
C
T
G
A
C
T
A
A
C
A
T
A
C
Genes: HD487LJBD4J

Composition

Beagle
18%
Husky
18%
Border Collie
18%
Rottweiler
9%
Golder Retriever
9%
German Shepard
9%
Grey Wolf
9%
St. Bernard
9%

Current Energy

Vitality -16 points
Lunar Effect -12 points

Traits Breakdown

Body Rottweiler
Tail Beagle
Legs Husky
Front Legs Golder Retriever
Head German Shepard
Ears Grey Wolf
Snout Border Collie
Mouth St. Bernard
Nose Beagle
Eyes Husky
Color Border Collie