Skitty Snickers Bitcoin Game Dog - Mix of Schnauzer, Corgi, Yorkshire Terrier, Poodle, Boxer, Grey Wolf, St. Bernard and Pug

Achievements

Racer
Skitty Snickers
Hi! My name is Skitty Snickers. Ultimate Frisbee is my favorite sport. I haven't really mastered the throwing part yet, but I have the catching part down! Ever play 'catch' with two humans then it turns into 'keep away'? Hate that. I'm hoping to find someone that doesn't mind the occasional gas after dinner!
  • Purity 8%
  • Age 39 months
  • Racing Exp 2
  • Schnauzer 18%
  • 2 races
  • Gen 0
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

2 races   |
  • 0 0 0
 Best Time16.37 sec
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: GACAACCCCATATGAGAAAGCAGCTTATTAATA
G
A
C
A
A
C
C
C
C
A
T
A
T
G
A
G
A
A
A
G
C
A
G
C
T
T
A
T
T
A
A
T
A
Genes: IGLCB2OOFFC

Composition

Schnauzer
18%
Corgi
18%
Yorkshire Terrier
18%
Poodle
9%
Boxer
9%
Grey Wolf
9%
St. Bernard
9%
Pug
9%

Current Energy

Vitality -35 points
Lunar Effect +4 points

Traits Breakdown

Body Poodle
Tail Boxer
Legs Grey Wolf
Front Legs Schnauzer
Head St. Bernard
Ears Pug
Snout Corgi
Mouth Corgi
Nose Yorkshire Terrier
Eyes Yorkshire Terrier
Color Schnauzer