Zoe Zeus Litecoin Dog - Mix of Dachshund, Golder Retriever, Poodle, Labrador BK, Boxer, Labrador, Pitbull terrier, Husky, Yorkshire Terrier and St. Bernard

Achievements

Racer
Zoe Zeus
If I can't reach it to clean it myself, it doesn't need cleaning! I like tennis balls. And baseballs. And squeaky balls. Really anything round and mouth-sized. I really dislike when my humans leave the house. Where could they possibly go that's better than my wonderful house? I just want to share a ball with someone, if you know what I mean...
  • Purity 1%
  • Age 22 months
  • Racing Exp 28
  • Dachshund 18%
  • 7 races
  • Gen 0
Make him happy share it to your friend*
Happy & Quick
Energy: ▂▃▅▆▇

Racing Stats

7 races   |
  • 3 0 0
 Best Time14.53 sec
Rank 79  Racing *** Coins
42.9 % wins (3) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: AGAGACGCAAACGGACCAGGATCCACATTATGA
A
G
A
G
A
C
G
C
A
A
A
C
G
G
A
C
C
A
G
G
A
T
C
C
A
C
A
T
T
A
T
G
A
Genes: 8I6GA5AN4FB

Composition

Dachshund
18%
Golder Retriever
9%
Poodle
9%
Labrador BK
9%
Boxer
9%
Labrador
9%
Pitbull terrier
9%
Husky
9%
Yorkshire Terrier
9%
St. Bernard
9%

Current Energy

Vitality -30 points
Lunar Effect -8 points

Traits Breakdown

Body Golder Retriever
Tail Poodle
Legs Labrador BK
Front Legs Boxer
Head Dachshund
Ears Labrador
Snout Dachshund
Mouth Pitbull terrier
Nose Husky
Eyes Yorkshire Terrier
Color St. Bernard

Parents

Children

Photos

Litecoin canine race results crypto dog racing cryptocurrency canine racing podium crypto doggy racing podium Litecoin doggy racing photo crypto pet racing results online doggy racing podium cryptocurrency pet racing results