Zoe Zeus Litecoin Dog - Mix of Dachshund, Golder Retriever, Poodle, Labrador BK, Boxer, Labrador, Pitbull terrier, Husky, Yorkshire Terrier and St. Bernard
Zoe Zeus
  • Purity 1%
  • Age 15 months
  • Racing Exp 0
  • Dachshund 18%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 0
Depressed & Snaillike

Achievements

None

Bio

If I can't reach it to clean it myself, it doesn't need cleaning! I like tennis balls. And baseballs. And squeaky balls. Really anything round and mouth-sized. I really dislike when my humans leave the house. Where could they possibly go that's better than my wonderful house? I just want to share a ball with someone, if you know what I mean...

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: AGAGACGCAAACGGACCAGGATCCACATTATGA
A
G
A
G
A
C
G
C
A
A
A
C
G
G
A
C
C
A
G
G
A
T
C
C
A
C
A
T
T
A
T
G
A
Genes: 8I6GA5AN4FB

Composition

Dachshund
18%
Golder Retriever
9%
Poodle
9%
Labrador BK
9%
Boxer
9%
Labrador
9%
Pitbull terrier
9%
Husky
9%
Yorkshire Terrier
9%
St. Bernard
9%

Current Energy

Vitality -30 points
Lunar Effect +2 points

Traits Breakdown

Body Golder Retriever
Tail Poodle
Legs Labrador BK
Front Legs Boxer
Head Dachshund
Ears Labrador
Snout Dachshund
Mouth Pitbull terrier
Nose Husky
Eyes Yorkshire Terrier
Color St. Bernard

Parents

No Children

Gift