Zoe Zeus Litecoin Dog - Mix of Dachshund, Golder Retriever, Poodle, Labrador BK, Boxer, Labrador, Pitbull terrier, Husky, Yorkshire Terrier and St. Bernard

Achievements

Racer
Podium Champion
Master Champion
Zoe Zeus
If I can't reach it to clean it myself, it doesn't need cleaning! I like tennis balls. And baseballs. And squeaky balls. Really anything round and mouth-sized. I really dislike when my humans leave the house. Where could they possibly go that's better than my wonderful house? I just want to share a ball with someone, if you know what I mean...
  • Purity 1%
  • Age 18 months
  • Racing Exp 93
  • Dachshund 18%
  • 26 races
  • Gen 0
Share it to make him Happy!
Sad & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

26 races   |
  • 4 4 3
 Best Time15.08 sec
No rank  Racing *** Pts
42.3 % wins (11) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: AGAGACGCAAACGGACCAGGATCCACATTATGA
A
G
A
G
A
C
G
C
A
A
A
C
G
G
A
C
C
A
G
G
A
T
C
C
A
C
A
T
T
A
T
G
A
Genes: 8I6GA5AN4FB

Composition

Dachshund
18%
Golder Retriever
9%
Poodle
9%
Labrador BK
9%
Boxer
9%
Labrador
9%
Pitbull terrier
9%
Husky
9%
Yorkshire Terrier
9%
St. Bernard
9%

Current Energy

Vitality -30 points
Lunar Effect +2 points

Traits Breakdown

Body Golder Retriever
Tail Poodle
Legs Labrador BK
Front Legs Boxer
Head Dachshund
Ears Labrador
Snout Dachshund
Mouth Pitbull terrier
Nose Husky
Eyes Yorkshire Terrier
Color St. Bernard

Parents

Children

Photos

crypto dog racing results Bitcoin dog racing podium Litecoin pet racing podium cryptocurrency dog race results cryptocurrency pet racing photo crypto dog race podium cryptocurrency canine race results online pet racing results