Nibby Newton Crypto Game Dog - Mix of Rottweiler, Corgi, Schnauzer, Husky, Pitbull terrier, Labrador BK, Shiba Inu, Dachshund and Poodle

Achievements

Racer
Nibby Newton
Size matters. This dawg's into big databases. Little Bow Wow is my favorite musician. I just assume he's a dog... I am on a mission to sniff all the butts in the world. ALL the butts. I hate never catching that damn rabbit in my dreams. I need someone that "brings home the bacon"!
  • Purity 3%
  • Age 21 months
  • Racing Exp 28
  • Rottweiler 18%
  • 7 races
  • Gen 0
Share it to make him Happy!
Sad & Tardy
Energy: ▂▃▅▆▇

Racing Stats

  • 0 1 3
7 races    Best Time15.27 sec
Rank 88  Racing *** Coins
57.1 % wins (4) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: ATAACATCCCACGCAGTAAGCGGAGACAGCCAC
A
T
A
A
C
A
T
C
C
C
A
C
G
C
A
G
T
A
A
G
C
G
G
A
G
A
C
A
G
C
C
A
C
Genes: C4NH6EOAIOH

Composition

Rottweiler
18%
Corgi
18%
Schnauzer
9%
Husky
9%
Pitbull terrier
9%
Labrador BK
9%
Shiba Inu
9%
Dachshund
9%
Poodle
9%

Current Energy

Vitality -45 points
Lunar Effect -4 points

Traits Breakdown

Body Schnauzer
Tail Husky
Legs Pitbull terrier
Front Legs Rottweiler
Head Labrador BK
Ears Shiba Inu
Snout Corgi
Mouth Dachshund
Nose Poodle
Eyes Corgi
Color Rottweiler