Nibby Newton Crypto Game Dog - Mix of Rottweiler, Corgi, Schnauzer, Husky, Pitbull terrier, Labrador BK, Shiba Inu, Dachshund and Poodle
Nibby Newton
  • Purity 3%
  • Age 13 months
  • Racing Exp 0
  • Rottweiler 18%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 0
Depressed & Snaillike

Achievements

None

Bio

Size matters. This dawg's into big databases. Little Bow Wow is my favorite musician. I just assume he's a dog... I am on a mission to sniff all the butts in the world. ALL the butts. I hate never catching that damn rabbit in my dreams. I need someone that "brings home the bacon"!

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: ATAACATCCCACGCAGTAAGCGGAGACAGCCAC
A
T
A
A
C
A
T
C
C
C
A
C
G
C
A
G
T
A
A
G
C
G
G
A
G
A
C
A
G
C
C
A
C
Genes: C4NH6EOAIOH

Composition

Rottweiler
18%
Corgi
18%
Schnauzer
9%
Husky
9%
Pitbull terrier
9%
Labrador BK
9%
Shiba Inu
9%
Dachshund
9%
Poodle
9%

Current Energy

Vitality -45 points
Lunar Effect -12 points

Traits Breakdown

Body Schnauzer
Tail Husky
Legs Pitbull terrier
Front Legs Rottweiler
Head Labrador BK
Ears Shiba Inu
Snout Corgi
Mouth Dachshund
Nose Poodle
Eyes Corgi
Color Rottweiler

Parents

No Children

Gift