Salty Skyler Cryptocurrency Dog - Mix of Husky, Grey Wolf, St. Bernard, Yorkshire Terrier, Border Collie, Beagle and Pug
Salty Skyler
  • Purity 9%
  • Age 17 months
  • Racing Exp 40
  • Husky 27%
  • Gold medal 3 Silver medal 1 Bronze medal 1
  • 8 races
  • Gen 0
Depressed & Snaillike

Achievements

Racer
Podium Champion

Bio

What's up, dog? I'm Salty Skyler! My AI may be artificial, but at least I'm intelligent. I love to find stinky things and roll in them. The stinkier, the better. Roadkill is my favorite! I'm not usually indecisive. But a new bone, a new slipper...so hard to decide!

Racing Stats

Ran 8 races
  • 3 1 1
 Best Time15.35 sec
Rank 52  RacingĀ *** Pts
62.5 % wins (5) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: CCCTTACCCACATACCTATGAACAACAGAATGA
C
C
C
T
T
A
C
C
C
A
C
A
T
A
C
C
T
A
T
G
A
A
C
A
A
C
A
G
A
A
T
G
A
Genes: LFL4JDB442B

Composition

Husky
27%
Grey Wolf
18%
St. Bernard
18%
Yorkshire Terrier
9%
Border Collie
9%
Beagle
9%
Pug
9%

Current Energy

Vitality +5 points
Lunar Effect -14 points

Traits Breakdown

Body Grey Wolf
Tail Yorkshire Terrier
Legs Grey Wolf
Front Legs Husky
Head Border Collie
Ears Beagle
Snout St. Bernard
Mouth Husky
Nose Husky
Eyes Pug
Color St. Bernard

Parents

No Children

Photos

Bitcoin dog race Litecoin doggy racing Bitcoin pet race Bitcoin pet racing Litecoin pet race
Gift