Kira Kaia Bitcoin Dog - Mix of Dachshund, Boxer, French Bulldog, Corgi, Shiba Inu, Pug, Border Collie, Labrador BK and Labrador

Achievements

Podium Champion
Pro Racer
Kira Kaia
Kira Kaia here, let's shake. I make the best virtual pet. I cry whenever I hear an ambulance siren! I'm not into dog collars, unless you're into S & M. I'm into recreational spankings and a little 'ruff' play. Walks on the beach are nice, but my favorite thing in the world is go shopping to PetCo for a new bone.
  • Purity 3%
  • Age 39 months
  • Racing Exp 58
  • Dachshund 18%
  • 15 races
  • Gen 0
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

15 races   |
  • 3 2 2
 Best Time16.17 sec
No rank  Racing *** Pts
46.7 % wins (7) Breeding *** Pts
Scheduled races 1 Total *** Pts

DNA Analysis

DNA Sequence: CGAAGCGGAGTAAACGAAAACTACGCACCAGGA
C
G
A
A
G
C
G
G
A
G
T
A
A
A
C
G
A
A
A
A
C
T
A
C
G
C
A
C
C
A
G
G
A
Genes: 9OAEG2GJ65A

Composition

Dachshund
18%
Boxer
18%
French Bulldog
9%
Corgi
9%
Shiba Inu
9%
Pug
9%
Border Collie
9%
Labrador BK
9%
Labrador
9%

Current Energy

Vitality -50 points
Lunar Effect -4 points

Traits Breakdown

Body French Bulldog
Tail Corgi
Legs Dachshund
Front Legs Shiba Inu
Head Boxer
Ears Pug
Snout Boxer
Mouth Border Collie
Nose Labrador BK
Eyes Labrador
Color Dachshund