Elf Ebony Cryptocurrency Game Dog - Mix of Labrador, Husky, Schnauzer, Grey Wolf, Pitbull terrier, German Shepard, Labrador BK and Poodle

Achievements

Racer
Elf Ebony
I don't like it when my bowl is empty, so I take it to my human and it magically refills! I love waking up early then indulging in long afternoon naps. They say my bite is worse than my bark. Hope you like the smell of wet fur, because I'll jump into any water I see!
  • Purity 6%
  • Age 18 months
  • Racing Exp 35
  • Labrador 27%
  • 15 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

15 races   |
  • 2 1 0
 Best Time16.17 sec
No rank  Racing *** Pts
20.0 % wins (3) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: ATACCCACATCCCCAACATCACCAGCAGACCCA
A
T
A
C
C
C
A
C
A
T
C
C
C
C
A
A
C
A
T
C
A
C
C
A
G
C
A
G
A
C
C
C
A
Genes: CL4N54756I5

Composition

Labrador
27%
Husky
18%
Schnauzer
9%
Grey Wolf
9%
Pitbull terrier
9%
German Shepard
9%
Labrador BK
9%
Poodle
9%

Current Energy

Vitality -45 points
Lunar Effect -4 points

Traits Breakdown

Body Schnauzer
Tail Grey Wolf
Legs Husky
Front Legs Pitbull terrier
Head Labrador
Ears Husky
Snout German Shepard
Mouth Labrador
Nose Labrador BK
Eyes Poodle
Color Labrador

Parents

No Children

Photos

cryptocurrency doggy race virtual doggy race photo cryptocurrency dog race