Argus Adelaide Cryptocurrency Dog - Mix of Schnauzer, St. Bernard, Rottweiler, Dachshund, Corgi, Pug, Grey Wolf and Maltese

Achievements

Racer
Argus Adelaide
I live in your digital dreams. I don't like it when my bowl is empty, so I take it to my human and it magically refills! I'm a serial monogamist. What's your favorite bed? Mine is the dirty laundry. I love spending my days curled up in a cozy blanket with a nice, fresh bone to chew.
  • Purity 8%
  • Age 18 months
  • Racing Exp 32
  • Schnauzer 27%
  • 15 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

15 races   |
  • 0 2 1
 Best Time15.77 sec
No rank  Racing *** Pts
20.0 % wins (3) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: CACTGAGGAAGCGAAATAATACCCTGAACCATA
C
A
C
T
G
A
G
G
A
A
G
C
G
A
A
A
T
A
A
T
A
C
C
C
T
G
A
A
C
C
A
T
A
Genes: HBAO2CCLBKC

Composition

Schnauzer
27%
St. Bernard
18%
Rottweiler
9%
Dachshund
9%
Corgi
9%
Pug
9%
Grey Wolf
9%
Maltese
9%

Current Energy

Vitality -45 points
Lunar Effect -16 points

Traits Breakdown

Body Rottweiler
Tail St. Bernard
Legs Dachshund
Front Legs Corgi
Head Pug
Ears Schnauzer
Snout Schnauzer
Mouth Grey Wolf
Nose St. Bernard
Eyes Maltese
Color Schnauzer

Parents

No Children

Photos

Bitcoin canine race cryptocurrency doggy racing podium cryptocurrency dog race results