Argus Adelaide Cryptocurrency Dog - Mix of Schnauzer, St. Bernard, Rottweiler, Dachshund, Corgi, Pug, Grey Wolf and Maltese

Achievements

Racer
Argus Adelaide
I live in your digital dreams. I don't like it when my bowl is empty, so I take it to my human and it magically refills! I'm a serial monogamist. What's your favorite bed? Mine is the dirty laundry. I love spending my days curled up in a cozy blanket with a nice, fresh bone to chew.
  • Purity 8%
  • Age 29 months
  • Racing Exp 4
  • Schnauzer 27%
  • 4 races
  • Gen 0
Make him happy share it to your friend*
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

4 races   |
  • 0 0 0
 Best Time15.77 sec
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CACTGAGGAAGCGAAATAATACCCTGAACCATA
C
A
C
T
G
A
G
G
A
A
G
C
G
A
A
A
T
A
A
T
A
C
C
C
T
G
A
A
C
C
A
T
A
Genes: HBAO2CCLBKC

Composition

Schnauzer
27%
St. Bernard
18%
Rottweiler
9%
Dachshund
9%
Corgi
9%
Pug
9%
Grey Wolf
9%
Maltese
9%

Current Energy

Vitality -45 points
Lunar Effect -16 points

Traits Breakdown

Body Rottweiler
Tail St. Bernard
Legs Dachshund
Front Legs Corgi
Head Pug
Ears Schnauzer
Snout Schnauzer
Mouth Grey Wolf
Nose St. Bernard
Eyes Maltese
Color Schnauzer