Argus Adelaide Cryptocurrency Dog - Mix of Schnauzer, St. Bernard, Rottweiler, Dachshund, Corgi, Pug, Grey Wolf and Maltese
Argus Adelaide
  • Purity 8%
  • Age 13 months
  • Racing Exp 4
  • Schnauzer 27%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 4 races
  • Gen 0
Depressed & Snaillike

Achievements

Racer

Bio

I live in your digital dreams. I don't like it when my bowl is empty, so I take it to my human and it magically refills! I'm a serial monogamist. What's your favorite bed? Mine is the dirty laundry. I love spending my days curled up in a cozy blanket with a nice, fresh bone to chew.

Racing Stats

Ran 4 races
  • 0 0 0
 Best Time15.77 sec
Rank 89  RacingĀ *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: CACTGAGGAAGCGAAATAATACCCTGAACCATA
C
A
C
T
G
A
G
G
A
A
G
C
G
A
A
A
T
A
A
T
A
C
C
C
T
G
A
A
C
C
A
T
A
Genes: HBAO2CCLBKC

Composition

Schnauzer
27%
St. Bernard
18%
Rottweiler
9%
Dachshund
9%
Corgi
9%
Pug
9%
Grey Wolf
9%
Maltese
9%

Current Energy

Vitality -45 points
Lunar Effect +6 points

Traits Breakdown

Body Rottweiler
Tail St. Bernard
Legs Dachshund
Front Legs Corgi
Head Pug
Ears Schnauzer
Snout Schnauzer
Mouth Grey Wolf
Nose St. Bernard
Eyes Maltese
Color Schnauzer

Parents

No Children

Photos

Gift