Major Mini Crypto Dog - Mix of Schnauzer, Pitbull terrier, Boxer, Labrador and Border Collie

Achievements

Racer
Major Mini
Ima cyber dog. The place I like most in the world is curled up in my human's bed, hogging all the covers! I like exploring off leash best. I don't mind sharing my bed with someone I just met, if we can cuddle. I hate not being allowed to hunt treasure in the garbage. It smells so good!
  • Purity 38%
  • Age 18 months
  • Racing Exp 34
  • Schnauzer 64%
  • 16 races
  • Gen 11
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

16 races   |
  • 0 3 0
 Best Time15.05 sec
No rank  Racing *** Pts
18.8 % wins (3) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: ATAATAATAATATCCAACATACCAATATACATA
A
T
A
A
T
A
A
T
A
A
T
A
T
C
C
A
A
C
A
T
A
C
C
A
A
T
A
T
A
C
A
T
A
Genes: CCCCNGC5CJC

Composition

Schnauzer
64%
Pitbull terrier
9%
Boxer
9%
Labrador
9%
Border Collie
9%

Current Energy

Vitality -55 points
Lunar Effect +16 points

Traits Breakdown

Body Schnauzer
Tail Schnauzer
Legs Schnauzer
Front Legs Schnauzer
Head Pitbull terrier
Ears Boxer
Snout Schnauzer
Mouth Labrador
Nose Schnauzer
Eyes Border Collie
Color Schnauzer

Parents

No Children

Photos

cryptocurrency canine race photo online dog racing podium virtual dog race