Major Mini Crypto Dog - Mix of Schnauzer, Pitbull terrier, Boxer, Labrador and Border Collie
Major Mini
  • Purity 38%
  • Age 14 months
  • Racing Exp 16
  • Schnauzer 64%
  • Gold medal 0 Silver medal 2 Bronze medal 0
  • 4 races
  • Gen 11
Depressed & Snaillike

Achievements

Racer

Bio

Ima cyber dog. The place I like most in the world is curled up in my human's bed, hogging all the covers! I like exploring off leash best. I don't mind sharing my bed with someone I just met, if we can cuddle. I hate not being allowed to hunt treasure in the garbage. It smells so good!

Racing Stats

Ran 4 races
  • 0 2 0
 Best Time15.05 sec
No rank  RacingĀ *** Pts
50.0 % wins (2) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: ATAATAATAATATCCAACATACCAATATACATA
A
T
A
A
T
A
A
T
A
A
T
A
T
C
C
A
A
C
A
T
A
C
C
A
A
T
A
T
A
C
A
T
A
Genes: CCCCNGC5CJC

Composition

Schnauzer
64%
Pitbull terrier
9%
Boxer
9%
Labrador
9%
Border Collie
9%

Current Energy

Vitality -55 points
Lunar Effect -16 points

Traits Breakdown

Body Schnauzer
Tail Schnauzer
Legs Schnauzer
Front Legs Schnauzer
Head Pitbull terrier
Ears Boxer
Snout Schnauzer
Mouth Labrador
Nose Schnauzer
Eyes Border Collie
Color Schnauzer