Satan's Dog Bitcoin Game Dog - Mix of Beagle, Boxer, German Shepard, French Bulldog, Schnauzer, Labrador, Corgi, Grey Wolf and Rottweiler

Achievements

Racer
Satan's Dog
I live in your digital dreams. I think hamsters and cats are both over-rated. After introductory sniffing, I like some licking. I hate having to share my food dish... I absolutely love long walks when I can stop and smell the bushes.
  • Purity 5%
  • Age 41 months
  • Racing Exp 1
  • Beagle 18%
  • 1 races
  • Gen 0
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
1 races    Best Time17.23 sec
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TCACTACGAATACTACCAAGCCCCAACAACCAC
T
C
A
C
T
A
C
G
A
A
T
A
C
T
A
C
C
A
A
G
C
C
C
C
A
A
C
A
A
C
C
A
C
Genes: 7D9CD5OLGGH

Composition

Beagle
18%
Boxer
18%
German Shepard
9%
French Bulldog
9%
Schnauzer
9%
Labrador
9%
Corgi
9%
Grey Wolf
9%
Rottweiler
9%

Current Energy

Vitality -43 points
Lunar Effect 0 points

Traits Breakdown

Body German Shepard
Tail Beagle
Legs French Bulldog
Front Legs Schnauzer
Head Beagle
Ears Labrador
Snout Corgi
Mouth Grey Wolf
Nose Boxer
Eyes Boxer
Color Rottweiler