Gage Goober Crypto Dog - Mix of Pug, Dachshund, Yorkshire Terrier, Golder Retriever, Shiba Inu, Border Collie, St. Bernard, Beagle, Labrador and Rottweiler

Achievements

Racer
Gage Goober
Howdy! I'm Gage Goober. I am a proud show dog. I like showing off my perfect coat! What's your favorite bed? Mine is the dirty laundry. Halloween costumes are the worst, I hate 'em! Oh, go ahead. Pet me. I know you want to.
  • Purity 1%
  • Age 39 months
  • Racing Exp 23
  • Pug 18%
  • 6 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

6 races   |
  • 1 0 2
 Best Time15.05 sec
No rank  Racing *** Pts
50.0 % wins (3) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: GGATTAGAAAGAGAAGTATACTGACTACCACAC
G
G
A
T
T
A
G
A
A
A
G
A
G
A
A
G
T
A
T
A
C
T
G
A
C
T
A
C
C
A
C
A
C
Genes: AF282EJBD5H

Composition

Pug
18%
Dachshund
9%
Yorkshire Terrier
9%
Golder Retriever
9%
Shiba Inu
9%
Border Collie
9%
St. Bernard
9%
Beagle
9%
Labrador
9%
Rottweiler
9%

Current Energy

Vitality -47 points
Lunar Effect -4 points

Traits Breakdown

Body Dachshund
Tail Yorkshire Terrier
Legs Pug
Front Legs Golder Retriever
Head Pug
Ears Shiba Inu
Snout Border Collie
Mouth St. Bernard
Nose Beagle
Eyes Labrador
Color Rottweiler

Parents

No Children

Photos

virtual doggy racing podium crypto dog racing virtual canine racing