Damon Droolius Caesar Cryptocurrency Dog - Mix of Golder Retriever and Labrador BK
Damon Droolius Caesar
  • Purity 82%
  • Age 18 months
  • Racing Exp 41
  • Golder Retriever 91%
  • Gold medal 4 Silver medal 1 Bronze medal 0
  • 7 races
  • Gen 10
Depressed & Snaillike

Achievements

Racer

Bio

My favorite movie is Dog Day Afternoon. I've never seen it but I like the title! I love cuddling up, doggy-style after a romantic evening. I'm a serial monogamist. I don't understand why my human tries to give me tap water. I expect filtered and distilled! I'm hoping to find someone who'll howl at the moon with me.

Racing Stats

Ran 7 races
  • 4 1 0
 Best Time15.02 sec
No rank  RacingĀ *** Pts
71.4 % wins (5) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: GCAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGA
G
C
A
A
G
A
A
G
A
A
G
A
A
G
A
A
G
A
A
G
A
A
G
A
A
G
A
A
G
A
A
G
A
Genes: 68888888888

Composition

Golder Retriever
91%
Labrador BK
9%

Current Energy

Vitality -29 points
Lunar Effect 0 points

Traits Breakdown

Body Labrador BK
Tail Golder Retriever
Legs Golder Retriever
Front Legs Golder Retriever
Head Golder Retriever
Ears Golder Retriever
Snout Golder Retriever
Mouth Golder Retriever
Nose Golder Retriever
Eyes Golder Retriever
Color Golder Retriever