Inez Itsy Litecoin Dog - Mix of German Shepard, Pug, Golder Retriever, Border Collie, Labrador BK, Beagle, Boxer, French Bulldog and Pitbull terrier
Inez Itsy
  • Purity 3%
  • Age 18 months
  • Racing Exp 0
  • German Shepard 18%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 0
Depressed & Snaillike

Achievements

None

Bio

How's it going? I'm Inez Itsy. Watching kids play without me is the worst, no? Oh, go ahead. Pet me. I know you want to. Creativity is my middle name... I turn everything in to a chew toy. My favorite pastime is playing tug-of-war with my human's underwear.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: AGATACGCATCACTAGAAAACTCACGAGAATCC
A
G
A
T
A
C
G
C
A
T
C
A
C
T
A
G
A
A
A
A
C
T
C
A
C
G
A
G
A
A
T
C
C
Genes: 8J67D2G792N

Composition

German Shepard
18%
Pug
18%
Golder Retriever
9%
Border Collie
9%
Labrador BK
9%
Beagle
9%
Boxer
9%
French Bulldog
9%
Pitbull terrier
9%

Current Energy

Vitality -14 points
Lunar Effect 0 points

Traits Breakdown

Body Golder Retriever
Tail Border Collie
Legs Labrador BK
Front Legs German Shepard
Head Beagle
Ears Pug
Snout Boxer
Mouth German Shepard
Nose French Bulldog
Eyes Pug
Color Pitbull terrier

Parents

No Children

Gift