Inez Itsy Litecoin Dog - Mix of German Shepard, Pug, Golder Retriever, Border Collie, Labrador BK, Beagle, Boxer, French Bulldog and Pitbull terrier

Achievements

None
Inez Itsy
How's it going? I'm Inez Itsy. Watching kids play without me is the worst, no? Oh, go ahead. Pet me. I know you want to. Creativity is my middle name... I turn everything in to a chew toy. My favorite pastime is playing tug-of-war with my human's underwear.
  • Purity 3%
  • Age 21 months
  • Racing Exp 0
  • German Shepard 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Sad & Slothful
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: AGATACGCATCACTAGAAAACTCACGAGAATCC
A
G
A
T
A
C
G
C
A
T
C
A
C
T
A
G
A
A
A
A
C
T
C
A
C
G
A
G
A
A
T
C
C
Genes: 8J67D2G792N

Composition

German Shepard
18%
Pug
18%
Golder Retriever
9%
Border Collie
9%
Labrador BK
9%
Beagle
9%
Boxer
9%
French Bulldog
9%
Pitbull terrier
9%

Current Energy

Vitality -14 points
Lunar Effect -8 points

Traits Breakdown

Body Golder Retriever
Tail Border Collie
Legs Labrador BK
Front Legs German Shepard
Head Beagle
Ears Pug
Snout Boxer
Mouth German Shepard
Nose French Bulldog
Eyes Pug
Color Pitbull terrier