T-Bone Tidus Bitcoin Dog - Mix of German Shepard, St. Bernard, Pitbull terrier, Rottweiler, Husky, Golder Retriever and Corgi
T-Bone Tidus
  • Purity 7%
  • Age 14 months
  • Racing Exp 0
  • German Shepard 27%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 0
Depressed & Snaillike

Achievements

None

Bio

My favorite treat is to steal the pepperoni off of pizza. Sometimes I forget where I buried my bone. I love digging. No particular reason, it just satisfies me to make a huge, muddy mess wherever I go. I'm totally against baths! They are the worst!

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: CACTGATCATCCTGATCAACAAGATCAAGCTCC
C
A
C
T
G
A
T
C
A
T
C
C
T
G
A
T
C
A
A
C
A
A
G
A
T
C
A
A
G
C
T
C
C
Genes: HB7NB7487ON

Composition

German Shepard
27%
St. Bernard
18%
Pitbull terrier
18%
Rottweiler
9%
Husky
9%
Golder Retriever
9%
Corgi
9%

Current Energy

Vitality -33 points
Lunar Effect -8 points

Traits Breakdown

Body Rottweiler
Tail St. Bernard
Legs German Shepard
Front Legs Pitbull terrier
Head St. Bernard
Ears German Shepard
Snout Husky
Mouth Golder Retriever
Nose German Shepard
Eyes Corgi
Color Pitbull terrier

Parents

No Children

Gift