T-Bone Tidus Bitcoin Dog - Mix of German Shepard, St. Bernard, Pitbull terrier, Rottweiler, Husky, Golder Retriever and Corgi

Achievements

None
T-Bone Tidus
My favorite treat is to steal the pepperoni off of pizza. Sometimes I forget where I buried my bone. I love digging. No particular reason, it just satisfies me to make a huge, muddy mess wherever I go. I'm totally against baths! They are the worst!
  • Purity 7%
  • Age 22 months
  • Racing Exp 0
  • German Shepard 27%
  • 0 races
  • Gen 0
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CACTGATCATCCTGATCAACAAGATCAAGCTCC
C
A
C
T
G
A
T
C
A
T
C
C
T
G
A
T
C
A
A
C
A
A
G
A
T
C
A
A
G
C
T
C
C
Genes: HB7NB7487ON

Composition

German Shepard
27%
St. Bernard
18%
Pitbull terrier
18%
Rottweiler
9%
Husky
9%
Golder Retriever
9%
Corgi
9%

Current Energy

Vitality -33 points
Lunar Effect +2 points

Traits Breakdown

Body Rottweiler
Tail St. Bernard
Legs German Shepard
Front Legs Pitbull terrier
Head St. Bernard
Ears German Shepard
Snout Husky
Mouth Golder Retriever
Nose German Shepard
Eyes Corgi
Color Pitbull terrier