T-Bird The Bat Crypto Dog - Mix of Labrador, German Shepard, Boxer, Border Collie, Grey Wolf, Pug, Husky and French Bulldog
T-Bird The Bat
  • Purity 4%
  • Age 14 months
  • Racing Exp 0
  • Labrador 18%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 0
Depressed & Snaillike

Achievements

None

Bio

Wassup? Yo, call me T-Bird The Bat. I am a guard dog for the data warehouse. I like to respond to sad puppy eyes with sad puppy eyes of my own. I'm totally against baths! They are the worst! I'm looking for someone smart enough to help me find the treat stash.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: TACCCACCCGAATCAACATCAAACCGACCAAAC
T
A
C
C
C
A
C
C
C
G
A
A
T
C
A
A
C
A
T
C
A
A
A
C
C
G
A
C
C
A
A
A
C
Genes: J5L2747G95G

Composition

Labrador
18%
German Shepard
18%
Boxer
18%
Border Collie
9%
Grey Wolf
9%
Pug
9%
Husky
9%
French Bulldog
9%

Current Energy

Vitality -27 points
Lunar Effect -12 points

Traits Breakdown

Body Border Collie
Tail Labrador
Legs Grey Wolf
Front Legs Pug
Head German Shepard
Ears Husky
Snout German Shepard
Mouth Boxer
Nose French Bulldog
Eyes Labrador
Color Boxer

Parents

No Children

Gift