T-Bird The Bat Crypto Dog - Mix of Labrador, German Shepard, Boxer, Border Collie, Grey Wolf, Pug, Husky and French Bulldog

Achievements

None
T-Bird The Bat
Wassup? Yo, call me T-Bird The Bat. I am a guard dog for the data warehouse. I like to respond to sad puppy eyes with sad puppy eyes of my own. I'm totally against baths! They are the worst! I'm looking for someone smart enough to help me find the treat stash.
  • Purity 4%
  • Age 22 months
  • Racing Exp 0
  • Labrador 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TACCCACCCGAATCAACATCAAACCGACCAAAC
T
A
C
C
C
A
C
C
C
G
A
A
T
C
A
A
C
A
T
C
A
A
A
C
C
G
A
C
C
A
A
A
C
Genes: J5L2747G95G

Composition

Labrador
18%
German Shepard
18%
Boxer
18%
Border Collie
9%
Grey Wolf
9%
Pug
9%
Husky
9%
French Bulldog
9%

Current Energy

Vitality -27 points
Lunar Effect -8 points

Traits Breakdown

Body Border Collie
Tail Labrador
Legs Grey Wolf
Front Legs Pug
Head German Shepard
Ears Husky
Snout German Shepard
Mouth Boxer
Nose French Bulldog
Eyes Labrador
Color Boxer