Sploot Shere Khan Crypto Dog - Mix of St. Bernard, Maltese, Pitbull terrier, Golder Retriever, Yorkshire Terrier, Schnauzer, Pug and Shiba Inu

Achievements

Racer
Sploot Shere Khan
Hi! I'm Sploot Shere Khan! I've been known to take mega bytes when playing ruff. What's your favorite bed? Mine is the dirty laundry. I wish my human wouldn't get mad at me for going through the trash. They were obviously finished with it, why can't I have it?! You scratch my belly and I'll scratch yours ;)
  • Purity 8%
  • Age 43 months
  • Racing Exp 2
  • St. Bernard 18%
  • 2 races
  • Gen 0
Make him happy share it to your friend*
Sad & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

2 races   |
  • 0 0 0
 Best Time16.25 sec
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: AGATTATGAACCACCTGAATATCCTCCGAAGTA
A
G
A
T
T
A
T
G
A
A
C
C
A
C
C
T
G
A
A
T
A
T
C
C
T
C
C
G
A
A
G
T
A
Genes: 8FBKKBCNN2E

Composition

St. Bernard
18%
Maltese
18%
Pitbull terrier
18%
Golder Retriever
9%
Yorkshire Terrier
9%
Schnauzer
9%
Pug
9%
Shiba Inu
9%

Current Energy

Vitality -47 points
Lunar Effect -2 points

Traits Breakdown

Body Golder Retriever
Tail Yorkshire Terrier
Legs St. Bernard
Front Legs Maltese
Head Maltese
Ears St. Bernard
Snout Schnauzer
Mouth Pitbull terrier
Nose Pitbull terrier
Eyes Pug
Color Shiba Inu