T-Bird Teddybear Litecoin Dog - Mix of Golder Retriever, Poodle, Pitbull terrier, Corgi, Shiba Inu and Border Collie

Achievements

Racer
T-Bird Teddybear
Greetings. My name is T-Bird Teddybear. My favorite chews are underwear and rawhide...the rawhide lasts longer. I hate bubble baths; mud puddles are more my style. I'd like to help you shed your coat, baby. I'm looking for someone who is also playful, feisty and happy.
  • Purity 27%
  • Age 23 months
  • Racing Exp 10
  • Golder Retriever 55%
  • 3 races
  • Gen 3
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

3 races   |
  • 1 0 0
 Best Time15.78 sec
No rank  Racing *** Pts
33.3 % wins (1) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: GACAGAAGATCCAGAAGCGTATACAGAAGAAGA
G
A
C
A
G
A
A
G
A
T
C
C
A
G
A
A
G
C
G
T
A
T
A
C
A
G
A
A
G
A
A
G
A
Genes: I88N8OEJ888

Composition

Golder Retriever
55%
Poodle
9%
Pitbull terrier
9%
Corgi
9%
Shiba Inu
9%
Border Collie
9%

Current Energy

Vitality -48 points
Lunar Effect -10 points

Traits Breakdown

Body Poodle
Tail Golder Retriever
Legs Golder Retriever
Front Legs Pitbull terrier
Head Golder Retriever
Ears Corgi
Snout Shiba Inu
Mouth Border Collie
Nose Golder Retriever
Eyes Golder Retriever
Color Golder Retriever

Parents

No Children

Photos

online dog racing