Winnie Watson Digital Cryptocurrency Dog - Mix of Husky, Border Collie, Shiba Inu, Golder Retriever, Labrador BK, Corgi, Yorkshire Terrier and Beagle

Achievements

None
Winnie Watson
I have a crush on the Grumpy cat. Bones I let age in the dirt develop my favorite flavor, but I don't recommend that with Oreos. I love barking all night when others try to sleep. I don't like having to stay in the car when my people go inside.
  • Purity 9%
  • Age 41 months
  • Racing Exp 0
  • Husky 27%
  • 0 races
  • Gen 0
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GTAAGATACACAACAACAGCAAGCTTACTATAC
G
T
A
A
G
A
T
A
C
A
C
A
A
C
A
A
C
A
G
C
A
A
G
C
T
T
A
C
T
A
T
A
C
Genes: E8J4446OFDJ

Composition

Husky
27%
Border Collie
18%
Shiba Inu
9%
Golder Retriever
9%
Labrador BK
9%
Corgi
9%
Yorkshire Terrier
9%
Beagle
9%

Current Energy

Vitality -15 points
Lunar Effect -4 points

Traits Breakdown

Body Shiba Inu
Tail Golder Retriever
Legs Border Collie
Front Legs Husky
Head Husky
Ears Husky
Snout Labrador BK
Mouth Corgi
Nose Yorkshire Terrier
Eyes Beagle
Color Border Collie