Maximus Mulligan Litecoin Dog - Mix of Corgi, Labrador, Dachshund, Pug, German Shepard, Pitbull terrier, Beagle, Boxer and Yorkshire Terrier

Achievements

Podium Champion
Pro Racer
Master Champion
Maximus Mulligan
Hi, I'm Maximus Mulligan. I feel totally safe lying naked on a rug in front of a digital fire, surrounded by firewalls. It turns me on when I can show an older dog a new trick. I like to play fetch with a tennis ball. If we can run as a pack for a while, I'm open to that.
  • Purity 3%
  • Age 39 months
  • Racing Exp 82
  • Corgi 18%
  • 20 races
  • Gen 0
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

20 races   |
  • 2 3 6
 Best Time15.88 sec
No rank  Racing *** Pts
55.0 % wins (11) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: GGAGAAAGCTCAAGCCCATCCCCACTAAACTTA
G
G
A
G
A
A
A
G
C
T
C
A
A
G
C
C
C
A
T
C
C
C
C
A
C
T
A
A
A
C
T
T
A
Genes: A2O7O5N5DGF

Composition

Corgi
18%
Labrador
18%
Dachshund
9%
Pug
9%
German Shepard
9%
Pitbull terrier
9%
Beagle
9%
Boxer
9%
Yorkshire Terrier
9%

Current Energy

Vitality -37 points
Lunar Effect -4 points

Traits Breakdown

Body Dachshund
Tail Pug
Legs Corgi
Front Legs German Shepard
Head Corgi
Ears Labrador
Snout Pitbull terrier
Mouth Labrador
Nose Beagle
Eyes Boxer
Color Yorkshire Terrier

Parents

No Children

Photos

virtual dog racing photo virtual dog race crypto pet racing results online pet racing results online dog race podium virtual dog racing results Litecoin dog race Litecoin doggy racing