Bond Balrog Crypto Dog - Mix of Poodle, Golder Retriever, Boxer, Dachshund, Labrador, Maltese, Corgi, Grey Wolf and Border Collie
Bond Balrog
  • Purity 5%
  • Age 37 months
  • Racing Exp 61
  • Poodle 18%
  • Gold medal 2 Silver medal 2 Bronze medal 3
  • 20 races
  • Gen 0
Depressed & Snaillike

Achievements

Racer
Podium Champion
TOP 10 Fastest

Bio

Hey! Call me Bond Balrog. I cry whenever I hear an ambulance siren! I hate the mailman! He's always trying to sneak up on me, but I've got my eye on him! I really enjoy squeaky toys! Well, I like ripping them apart and taking out the squeaker! You'll find me walking into my favorite pet store like I own the place. I do, don't I?

Racing Stats

Ran 20 races
  • 2 2 3
 Best Time15.52 sec
Rank 6  RacingĀ *** Pts
35.0 % wins (7) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: AACGGACCAACCGACGACAGCAGACCCTACAGA
A
A
C
G
G
A
C
C
A
A
C
C
G
A
C
G
A
C
A
G
C
A
G
A
C
C
C
T
A
C
A
G
A
Genes: GA5KIIO8LJ8

Composition

Poodle
18%
Golder Retriever
18%
Boxer
9%
Dachshund
9%
Labrador
9%
Maltese
9%
Corgi
9%
Grey Wolf
9%
Border Collie
9%

Current Energy

Vitality -41 points
Lunar Effect -4 points

Traits Breakdown

Body Boxer
Tail Dachshund
Legs Labrador
Front Legs Maltese
Head Poodle
Ears Poodle
Snout Corgi
Mouth Golder Retriever
Nose Grey Wolf
Eyes Border Collie
Color Golder Retriever

Parents

No Children

Photos

cryptocurrency canine racing Litecoin canine race Bitcoin dog racing Litecoin canine race online canine racing podium cryptocurrency doggy racing podium Litecoin doggy race
Gift