Bond Balrog Crypto Dog - Mix of Poodle, Golder Retriever, Boxer, Dachshund, Labrador, Maltese, Corgi, Grey Wolf and Border Collie
Bond Balrog
  • Purity 5%
  • Age 72 months
  • Racing Exp 67
  • Poodle 18%
  • Gold medal 2 Silver medal 2 Bronze medal 4
  • 21 races
  • Gen 0
Depressed & Snaillike

Achievements

Racer
Podium Champion

Bio

Hey! Call me Bond Balrog. I cry whenever I hear an ambulance siren! I hate the mailman! He's always trying to sneak up on me, but I've got my eye on him! I really enjoy squeaky toys! Well, I like ripping them apart and taking out the squeaker! You'll find me walking into my favorite pet store like I own the place. I do, don't I?

Racing Stats

Ran 21 races
  • 2 2 4
 Best Time15.52 sec
Rank 11  RacingĀ *** Pts
38.1% wins (8) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: AACGGACCAACCGACGACAGCAGACCCTACAGA
A
A
C
G
G
A
C
C
A
A
C
C
G
A
C
G
A
C
A
G
C
A
G
A
C
C
C
T
A
C
A
G
A
Genes: GA5KIIO8LJ8

Composition

Poodle
18%
Golder Retriever
18%
Boxer
9%
Dachshund
9%
Labrador
9%
Maltese
9%
Corgi
9%
Grey Wolf
9%
Border Collie
9%

Current Energy

Vitality -41 points
Lunar Effect -4 points

Traits Breakdown

Body Boxer
Tail Dachshund
Legs Labrador
Front Legs Maltese
Head Poodle
Ears Poodle
Snout Corgi
Mouth Golder Retriever
Nose Grey Wolf
Eyes Border Collie
Color Golder Retriever

Parents

No Children

Photos

Bitcoin doggy race results crypto dog race online doggy racing podium Bitcoin dog racing Bitcoin dog racing cryptocurrency dog race virtual pet race online canine race results
Gift