Bond Balrog Crypto Dog - Mix of Poodle, Golder Retriever, Boxer, Dachshund, Labrador, Maltese, Corgi, Grey Wolf and Border Collie

Achievements

Racer
Bond Balrog
Hey! Call me Bond Balrog. I cry whenever I hear an ambulance siren! I hate the mailman! He's always trying to sneak up on me, but I've got my eye on him! I really enjoy squeaky toys! Well, I like ripping them apart and taking out the squeaker! You'll find me walking into my favorite pet store like I own the place. I do, don't I?
  • Purity 5%
  • Age 41 months
  • Racing Exp 1
  • Poodle 18%
  • 1 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
1 races    Best Time17.45 sec
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: AACGGACCAACCGACGACAGCAGACCCTACAGA
A
A
C
G
G
A
C
C
A
A
C
C
G
A
C
G
A
C
A
G
C
A
G
A
C
C
C
T
A
C
A
G
A
Genes: GA5KIIO8LJ8

Composition

Poodle
18%
Golder Retriever
18%
Boxer
9%
Dachshund
9%
Labrador
9%
Maltese
9%
Corgi
9%
Grey Wolf
9%
Border Collie
9%

Current Energy

Vitality -41 points
Lunar Effect -16 points

Traits Breakdown

Body Boxer
Tail Dachshund
Legs Labrador
Front Legs Maltese
Head Poodle
Ears Poodle
Snout Corgi
Mouth Golder Retriever
Nose Grey Wolf
Eyes Border Collie
Color Golder Retriever