Chucky Cici Bitcoin Game Dog - Mix of Dachshund, Border Collie, Labrador, Golder Retriever, Grey Wolf, Pitbull terrier and Rottweiler

Achievements

None
Chucky Cici
Well hello, beautiful. My name's Chucky Cici. I work in The Virtual Machine. I love the smell of freshly cut grass. My favorite position is doggie style ;) If you have fleas or ticks, don't bother. Those flying monkeys in the Wizard of Oz still scare me!
  • Purity 9%
  • Age 29 months
  • Racing Exp 0
  • Dachshund 27%
  • 0 races
  • Gen 1
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TACAGACCATACCCCGGATCCGGAGGACACCCA
T
A
C
A
G
A
C
C
A
T
A
C
C
C
C
G
G
A
T
C
C
G
G
A
G
G
A
C
A
C
C
C
A
Genes: J85JLANAAH5

Composition

Dachshund
27%
Border Collie
18%
Labrador
18%
Golder Retriever
9%
Grey Wolf
9%
Pitbull terrier
9%
Rottweiler
9%

Current Energy

Vitality -10 points
Lunar Effect -16 points

Traits Breakdown

Body Border Collie
Tail Golder Retriever
Legs Labrador
Front Legs Border Collie
Head Grey Wolf
Ears Dachshund
Snout Pitbull terrier
Mouth Dachshund
Nose Dachshund
Eyes Rottweiler
Color Labrador