Angelina Augie Crypto Dog - Mix of French Bulldog, Golder Retriever, Border Collie, Maltese, Husky, Labrador, Schnauzer and Shiba Inu

Achievements

Racer
Angelina Augie
Hey there! Baby, call me Angelina Augie. I live in your digital dreams. My favorite position is doggie style ;) Once I caught a seagull, but it scared me so I let it go. I hate it when humans put the lid down. I like to eat. Anything and everything. Old or new. My stomach doesn't discriminate! I'm not that picky. Wanna mate?
  • Purity 4%
  • Age 39 months
  • Racing Exp 59
  • French Bulldog 18%
  • 21 races
  • Gen 0
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

21 races   |
  • 0 3 4
 Best Time15.55 sec
No rank  Racing *** Pts
33.3 % wins (7) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: CGAACCAGAACACGAAGACCATACATAGTATAC
C
G
A
A
C
C
A
G
A
A
C
A
C
G
A
A
G
A
C
C
A
T
A
C
A
T
A
G
T
A
T
A
C
Genes: 9K84985JCEJ

Composition

French Bulldog
18%
Golder Retriever
18%
Border Collie
18%
Maltese
9%
Husky
9%
Labrador
9%
Schnauzer
9%
Shiba Inu
9%

Current Energy

Vitality -27 points
Lunar Effect -4 points

Traits Breakdown

Body French Bulldog
Tail Maltese
Legs Golder Retriever
Front Legs Husky
Head French Bulldog
Ears Golder Retriever
Snout Labrador
Mouth Border Collie
Nose Schnauzer
Eyes Shiba Inu
Color Border Collie

Parents

No Children

Photos

Litecoin canine racing Litecoin doggy race podium Litecoin dog racing podium virtual pet race podium crypto doggy racing virtual dog race results Bitcoin pet racing