Dixie Dazzle Litecoin Game Dog - Mix of Poodle, Grey Wolf, Beagle, Golder Retriever, St. Bernard, Pitbull terrier, Boxer and Maltese

Achievements

None
Dixie Dazzle
Suh? How's it goin? I'm Dixie Dazzle. Bones I let age in the dirt develop my favorite flavor, but I don't recommend that with Oreos. I hate having to share my food dish... I never met a leg I didn't want to hump. I love to find stinky things and roll in them. The stinkier, the better. Roadkill is my favorite!
  • Purity 6%
  • Age 31 months
  • Racing Exp 0
  • Poodle 18%
  • 0 races
  • Gen 0
Make him happy share it to your friend*
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: AGAGACTGAGACCCCCCCTCCCTAAACCTAACC
A
G
A
G
A
C
T
G
A
G
A
C
C
C
C
C
C
C
T
C
C
C
T
A
A
A
C
C
T
A
A
C
C
Genes: 8IBILLNDGDK

Composition

Poodle
18%
Grey Wolf
18%
Beagle
18%
Golder Retriever
9%
St. Bernard
9%
Pitbull terrier
9%
Boxer
9%
Maltese
9%

Current Energy

Vitality -43 points
Lunar Effect -16 points

Traits Breakdown

Body Golder Retriever
Tail Poodle
Legs St. Bernard
Front Legs Poodle
Head Grey Wolf
Ears Grey Wolf
Snout Pitbull terrier
Mouth Beagle
Nose Boxer
Eyes Beagle
Color Maltese