Mischief Muffin Litecoin Game Dog - Mix of Labrador BK, Yorkshire Terrier, St. Bernard, Corgi, Grey Wolf, Schnauzer, Rottweiler, Dachshund, Boxer and French Bulldog

Achievements

Pro Racer
Podium Champion
Master Champion
Mischief Muffin
How you doin? ;) Mischief Muffin here. I love unconditionally. My favorite position is doggie style ;) I've had my nose rubbed in 'it' more than once. I don't like to be ignored.
  • Purity 1%
  • Age 39 months
  • Racing Exp 173
  • Labrador BK 18%
  • 40 races
  • Gen 0
Share it to make him Happy!
Neutral & Casual
Energy: ▂▃▅▆▇

Racing Stats

40 races   |
  • 4 10 9
 Best Time15.05 sec
No rank  Racing *** Pts
57.5 % wins (23) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: TTATGAGCAAGCCCCATACACGGAGCAAACCGA
T
T
A
T
G
A
G
C
A
A
G
C
C
C
C
A
T
A
C
A
C
G
G
A
G
C
A
A
A
C
C
G
A
Genes: FB6OLCHA6G9

Composition

Labrador BK
18%
Yorkshire Terrier
9%
St. Bernard
9%
Corgi
9%
Grey Wolf
9%
Schnauzer
9%
Rottweiler
9%
Dachshund
9%
Boxer
9%
French Bulldog
9%

Current Energy

Vitality -33 points
Lunar Effect -8 points

Traits Breakdown

Body Yorkshire Terrier
Tail St. Bernard
Legs Labrador BK
Front Legs Corgi
Head Grey Wolf
Ears Schnauzer
Snout Rottweiler
Mouth Dachshund
Nose Labrador BK
Eyes Boxer
Color French Bulldog