Mischief Muffin Litecoin Game Dog - Mix of Labrador BK, Yorkshire Terrier, St. Bernard, Corgi, Grey Wolf, Schnauzer, Rottweiler, Dachshund, Boxer and French Bulldog

Achievements

Pro Racer
Podium Champion
Mischief Muffin
How you doin? ;) Mischief Muffin here. I love unconditionally. My favorite position is doggie style ;) I've had my nose rubbed in 'it' more than once. I don't like to be ignored.
  • Purity 1%
  • Age 42 months
  • Racing Exp 73
  • Labrador BK 18%
  • 19 races
  • Gen 0
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 1 7 1
19 races    Best Time15.05 sec
No rank  Racing *** Coins
47.4 % wins (9) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TTATGAGCAAGCCCCATACACGGAGCAAACCGA
T
T
A
T
G
A
G
C
A
A
G
C
C
C
C
A
T
A
C
A
C
G
G
A
G
C
A
A
A
C
C
G
A
Genes: FB6OLCHA6G9

Composition

Labrador BK
18%
Yorkshire Terrier
9%
St. Bernard
9%
Corgi
9%
Grey Wolf
9%
Schnauzer
9%
Rottweiler
9%
Dachshund
9%
Boxer
9%
French Bulldog
9%

Current Energy

Vitality -33 points
Lunar Effect -14 points

Traits Breakdown

Body Yorkshire Terrier
Tail St. Bernard
Legs Labrador BK
Front Legs Corgi
Head Grey Wolf
Ears Schnauzer
Snout Rottweiler
Mouth Dachshund
Nose Labrador BK
Eyes Boxer
Color French Bulldog