Maggy Molly Bitcoin Dog - Mix of French Bulldog, Maltese, Grey Wolf, Golder Retriever, Labrador, German Shepard, Pug, Corgi, Yorkshire Terrier and Pitbull terrier

Achievements

Racer
Maggy Molly
I could spend days on end chasing my tail. I get so close but it's just so fast! I wish my human wouldn't get mad at me for going through the trash. They were obviously finished with it, why can't I have it?! I need laid otherwise I'm going to start agreeing with Grumpy Cat.
  • Purity 1%
  • Age 42 months
  • Racing Exp 16
  • French Bulldog 18%
  • 4 races
  • Gen 0
Make him happy share it to your friend*
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

4 races   |
  • 0 2 0
 Best Time14.73 sec
No rank  Racing *** Coins
50.0 % wins (2) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: ACCCGACCCAGACCATCACGAGAAAGCTTATCC
A
C
C
C
G
A
C
C
C
A
G
A
C
C
A
T
C
A
C
G
A
G
A
A
A
G
C
T
T
A
T
C
C
Genes: K9L85792OFN

Composition

French Bulldog
18%
Maltese
9%
Grey Wolf
9%
Golder Retriever
9%
Labrador
9%
German Shepard
9%
Pug
9%
Corgi
9%
Yorkshire Terrier
9%
Pitbull terrier
9%

Current Energy

Vitality -40 points
Lunar Effect 0 points

Traits Breakdown

Body Maltese
Tail French Bulldog
Legs Grey Wolf
Front Legs Golder Retriever
Head Labrador
Ears German Shepard
Snout French Bulldog
Mouth Pug
Nose Corgi
Eyes Yorkshire Terrier
Color Pitbull terrier