Sampson Salty Crypto Game Dog - Mix of French Bulldog, Husky, Labrador, Beagle, Maltese, Poodle and Shiba Inu

Achievements

Racer
Speed Champion
Sampson Salty
How goes it? I'm Sampson Salty. I live in cyberspace where you can turn me on. I hate it when my humans fool me with a pill in peanut butter! I'd like to help you shed your coat, baby. I wish I could spend every weekend going camping with my human. All the animals out there smell so funny!
  • Purity 9%
  • Age 38 months
  • Racing Exp 29
  • French Bulldog 27%
  • 8 races
  • Gen 0
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

8 races   |
  • 3 0 0
 Best Time13.43 sec
No rank  Racing *** Pts
37.5 % wins (3) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: ACACGACCAACACTAACCCGACGAGACGTACCA
A
C
A
C
G
A
C
C
A
A
C
A
C
T
A
A
C
C
C
G
A
C
G
A
G
A
C
G
T
A
C
C
A
Genes: 4954DK99IE5

Composition

French Bulldog
27%
Husky
18%
Labrador
18%
Beagle
9%
Maltese
9%
Poodle
9%
Shiba Inu
9%

Current Energy

Vitality -10 points
Lunar Effect -4 points

Traits Breakdown

Body Husky
Tail French Bulldog
Legs Labrador
Front Legs Husky
Head Beagle
Ears Maltese
Snout French Bulldog
Mouth French Bulldog
Nose Poodle
Eyes Shiba Inu
Color Labrador