Buzzy Bloop Cryptocurrency Game Dog - Mix of Poodle, Labrador, Shiba Inu, Rottweiler, Maltese, Pug and Yorkshire Terrier

Achievements

None
Buzzy Bloop
Howdy there. I'm Buzzy Bloop. My favorite way to relax is to be scratched on my belly. I'm not a fan of sleeping on the floor. This body was made for cuddles! I'm a serial monogamist. I am really into starting howling wars with the neighborhood dogs. I'm the loudest!
  • Purity 11%
  • Age 42 months
  • Racing Exp 0
  • Poodle 27%
  • 0 races
  • Gen 0
Make him happy share it to your friend*
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GTAGACCACGACACCGACCCAGAATTACCACCA
G
T
A
G
A
C
C
A
C
G
A
C
A
C
C
G
A
C
C
C
A
G
A
A
T
T
A
C
C
A
C
C
A
Genes: EIHIKI52F55

Composition

Poodle
27%
Labrador
27%
Shiba Inu
9%
Rottweiler
9%
Maltese
9%
Pug
9%
Yorkshire Terrier
9%

Current Energy

Vitality -45 points
Lunar Effect -4 points

Traits Breakdown

Body Shiba Inu
Tail Poodle
Legs Rottweiler
Front Legs Poodle
Head Maltese
Ears Poodle
Snout Labrador
Mouth Pug
Nose Yorkshire Terrier
Eyes Labrador
Color Labrador