Buzzy Bloop Cryptocurrency Game Dog - Mix of Poodle, Labrador, Shiba Inu, Rottweiler, Maltese, Pug and Yorkshire Terrier

Achievements

Racer
Buzzy Bloop
Howdy there. I'm Buzzy Bloop. My favorite way to relax is to be scratched on my belly. I'm not a fan of sleeping on the floor. This body was made for cuddles! I'm a serial monogamist. I am really into starting howling wars with the neighborhood dogs. I'm the loudest!
  • Purity 11%
  • Age 38 months
  • Racing Exp 7
  • Poodle 27%
  • 2 races
  • Gen 0
Share it to make him Happy!
Sad & Tardy
Energy: ▂▃▅▆▇

Racing Stats

2 races   |
  • 0 0 1
 Best Time15.67 sec
No rank  Racing *** Pts
50.0 % wins (1) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: GTAGACCACGACACCGACCCAGAATTACCACCA
G
T
A
G
A
C
C
A
C
G
A
C
A
C
C
G
A
C
C
C
A
G
A
A
T
T
A
C
C
A
C
C
A
Genes: EIHIKI52F55

Composition

Poodle
27%
Labrador
27%
Shiba Inu
9%
Rottweiler
9%
Maltese
9%
Pug
9%
Yorkshire Terrier
9%

Current Energy

Vitality -45 points
Lunar Effect +12 points

Traits Breakdown

Body Shiba Inu
Tail Poodle
Legs Rottweiler
Front Legs Poodle
Head Maltese
Ears Poodle
Snout Labrador
Mouth Pug
Nose Yorkshire Terrier
Eyes Labrador
Color Labrador

Parents

Children

Photos

Litecoin canine racing results