Scotty Scooby Bitcoin Dog - Mix of Pug, Husky, Grey Wolf, French Bulldog, Border Collie, Poodle, Shiba Inu, Labrador, Labrador BK and St. Bernard

Achievements

None
Scotty Scooby
I live inside of a web app in a big data center. I don't like it when my bowl is empty, so I take it to my human and it magically refills! In my humble opinion the best toy is one of my human's stinky, old socks. I'm looking for a good Tug-O-War partner.
  • Purity 3%
  • Age 43 months
  • Racing Exp 0
  • Pug 18%
  • 0 races
  • Gen 0
Make him happy share it to your friend*
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: ACACCCCGATACGACGTACCAGAAGAAGCATGA
A
C
A
C
C
C
C
G
A
T
A
C
G
A
C
G
T
A
C
C
A
G
A
A
G
A
A
G
C
A
T
G
A
Genes: 4L9JIE5226B

Composition

Pug
18%
Husky
9%
Grey Wolf
9%
French Bulldog
9%
Border Collie
9%
Poodle
9%
Shiba Inu
9%
Labrador
9%
Labrador BK
9%
St. Bernard
9%

Current Energy

Vitality -23 points
Lunar Effect +2 points

Traits Breakdown

Body Husky
Tail Grey Wolf
Legs French Bulldog
Front Legs Border Collie
Head Poodle
Ears Shiba Inu
Snout Labrador
Mouth Pug
Nose Pug
Eyes Labrador BK
Color St. Bernard