Scotty Scooby Bitcoin Dog - Mix of Pug, Husky, Grey Wolf, French Bulldog, Border Collie, Poodle, Shiba Inu, Labrador, Labrador BK and St. Bernard

Achievements

Racer
Podium Champion
Master Champion
Scotty Scooby
I live inside of a web app in a big data center. I don't like it when my bowl is empty, so I take it to my human and it magically refills! In my humble opinion the best toy is one of my human's stinky, old socks. I'm looking for a good Tug-O-War partner.
  • Purity 3%
  • Age 39 months
  • Racing Exp 158
  • Pug 18%
  • 44 races
  • Gen 0
Share it to make him Happy!
Happy & Quick
Energy: ▂▃▅▆▇

Racing Stats

44 races   |
  • 5 4 11
 Best Time15.53 sec
No rank  Racing *** Pts
45.5 % wins (20) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: ACACCCCGATACGACGTACCAGAAGAAGCATGA
A
C
A
C
C
C
C
G
A
T
A
C
G
A
C
G
T
A
C
C
A
G
A
A
G
A
A
G
C
A
T
G
A
Genes: 4L9JIE5226B

Composition

Pug
18%
Husky
9%
Grey Wolf
9%
French Bulldog
9%
Border Collie
9%
Poodle
9%
Shiba Inu
9%
Labrador
9%
Labrador BK
9%
St. Bernard
9%

Current Energy

Vitality -23 points
Lunar Effect -4 points

Traits Breakdown

Body Husky
Tail Grey Wolf
Legs French Bulldog
Front Legs Border Collie
Head Poodle
Ears Shiba Inu
Snout Labrador
Mouth Pug
Nose Pug
Eyes Labrador BK
Color St. Bernard