Scotty Scooby Bitcoin Dog - Mix of Pug, Husky, Grey Wolf, French Bulldog, Border Collie, Poodle, Shiba Inu, Labrador, Labrador BK and St. Bernard
Scotty Scooby
  • Purity 3%
  • Age 72 months
  • Racing Exp 86
  • Pug 18%
  • Gold medal 1 Silver medal 3 Bronze medal 7
  • 26 races
  • Gen 0
Depressed & Snaillike

Achievements

Racer
Podium Champion
Master Champion

Bio

I live inside of a web app in a big data center. I don't like it when my bowl is empty, so I take it to my human and it magically refills! In my humble opinion the best toy is one of my human's stinky, old socks. I'm looking for a good Tug-O-War partner.

Racing Stats

Ran 26 races
  • 1 3 7
 Best Time16.10 sec
Rank 45  RacingĀ *** Pts
42.3% wins (11) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: ACACCCCGATACGACGTACCAGAAGAAGCATGA
A
C
A
C
C
C
C
G
A
T
A
C
G
A
C
G
T
A
C
C
A
G
A
A
G
A
A
G
C
A
T
G
A
Genes: 4L9JIE5226B

Composition

Pug
18%
Husky
9%
Grey Wolf
9%
French Bulldog
9%
Border Collie
9%
Poodle
9%
Shiba Inu
9%
Labrador
9%
Labrador BK
9%
St. Bernard
9%

Current Energy

Vitality -23 points
Lunar Effect -8 points

Traits Breakdown

Body Husky
Tail Grey Wolf
Legs French Bulldog
Front Legs Border Collie
Head Poodle
Ears Shiba Inu
Snout Labrador
Mouth Pug
Nose Pug
Eyes Labrador BK
Color St. Bernard

Parents

No Children

Photos

crypto canine racing podium Litecoin pet racing Litecoin pet racing podium cryptocurrency canine race photo virtual pet racing results Bitcoin doggy racing results virtual dog race photo crypto dog race
Gift