Bada Bing Litecoin Game Dog - Mix of Beagle, French Bulldog, Poodle, Dachshund, German Shepard, Pug, Pitbull terrier and Labrador
Bada Bing
  • Purity 8%
  • Age 73 months
  • Racing Exp 22
  • Beagle 27%
  • Gold medal 2 Silver medal 0 Bronze medal 1
  • 3 races
  • Gen 0
Ecstatic & Fast

Achievements

Racer

Bio

Yo dog! Bada Bing here. Taking a break from chasing Nyan Cat around cyberspace. I like giving wet kisses. My favorite movie is Dog Day Afternoon. I've never seen it but I like the title! I cry whenever I hear an ambulance siren! I want a mate that knows how to give a proper belly rub!

Racing Stats

Ran 3 races
  • 2 0 1
 Best Time16.75 sec
No rank  RacingĀ *** Pts
100.0% wins (3) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: GACGGACTATCAGAACGATCCCCACTACTACGA
G
A
C
G
G
A
C
T
A
T
C
A
G
A
A
C
G
A
T
C
C
C
C
A
C
T
A
C
T
A
C
G
A
Genes: IAD729N5DD9

Composition

Beagle
27%
French Bulldog
18%
Poodle
9%
Dachshund
9%
German Shepard
9%
Pug
9%
Pitbull terrier
9%
Labrador
9%

Current Energy

Vitality -48 points
Lunar Effect -4 points

Traits Breakdown

Body Poodle
Tail Dachshund
Legs Beagle
Front Legs German Shepard
Head Pug
Ears French Bulldog
Snout Pitbull terrier
Mouth Labrador
Nose Beagle
Eyes Beagle
Color French Bulldog

Parents

No Children

Photos

virtual pet racing Bitcoin dog race cryptocurrency dog race photo virtual pet racing photo virtual pet racing photo cryptocurrency doggy race virtual pet racing Litecoin canine race results
Gift