Bada Bing Litecoin Game Dog - Mix of Beagle, French Bulldog, Poodle, Dachshund, German Shepard, Pug, Pitbull terrier and Labrador

Achievements

None
Bada Bing
Yo dog! Bada Bing here. Taking a break from chasing Nyan Cat around cyberspace. I like giving wet kisses. My favorite movie is Dog Day Afternoon. I've never seen it but I like the title! I cry whenever I hear an ambulance siren! I want a mate that knows how to give a proper belly rub!
  • Purity 8%
  • Age 42 months
  • Racing Exp 0
  • Beagle 27%
  • 0 races
  • Gen 0
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GACGGACTATCAGAACGATCCCCACTACTACGA
G
A
C
G
G
A
C
T
A
T
C
A
G
A
A
C
G
A
T
C
C
C
C
A
C
T
A
C
T
A
C
G
A
Genes: IAD729N5DD9

Composition

Beagle
27%
French Bulldog
18%
Poodle
9%
Dachshund
9%
German Shepard
9%
Pug
9%
Pitbull terrier
9%
Labrador
9%

Current Energy

Vitality -48 points
Lunar Effect -14 points

Traits Breakdown

Body Poodle
Tail Dachshund
Legs Beagle
Front Legs German Shepard
Head Pug
Ears French Bulldog
Snout Pitbull terrier
Mouth Labrador
Nose Beagle
Eyes Beagle
Color French Bulldog