Paddington Pete Digital Cryptocurrency Dog - Mix of Beagle, Corgi, Golder Retriever, Grey Wolf, Yorkshire Terrier, Border Collie, St. Bernard, Husky and Pug

Achievements

Racer
Paddington Pete
Hello, I'm Paddington Pete. How's it goin'? Taking a break from chasing Nyan Cat around cyberspace. I'm a serial monogamist. My favorite thing is to sit in my humans' laps while they are trying to read or drive. My turn-offs are rolled up newspapers and loud noises.
  • Purity 7%
  • Age 38 months
  • Racing Exp 1
  • Beagle 18%
  • 1 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

1 races   |
  • 0 0 0
 Best Time18.05 sec
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: CTACTAAGACCCTTATACTGAACAAGCAGCGAA
C
T
A
C
T
A
A
G
A
C
C
C
T
T
A
T
A
C
T
G
A
A
C
A
A
G
C
A
G
C
G
A
A
Genes: DD8LFJB4OO2

Composition

Beagle
18%
Corgi
18%
Golder Retriever
9%
Grey Wolf
9%
Yorkshire Terrier
9%
Border Collie
9%
St. Bernard
9%
Husky
9%
Pug
9%

Current Energy

Vitality -32 points
Lunar Effect -4 points

Traits Breakdown

Body Beagle
Tail Beagle
Legs Golder Retriever
Front Legs Grey Wolf
Head Yorkshire Terrier
Ears Border Collie
Snout St. Bernard
Mouth Husky
Nose Corgi
Eyes Corgi
Color Pug

Parents

No Children

Photos