Macy Megan Digital Cryptocurrency Dog - Mix of Yorkshire Terrier, Schnauzer, Pitbull terrier, Corgi and Beagle

Achievements

None
Macy Megan
Howdy potential partner! Macy Megan here. Slipping my collar, running off and making my humans worried? Every chance I get. Those flying monkeys in the Wizard of Oz still scare me! I'm always up for a nice long walk around the neighborhood. I need someone that "brings home the bacon"!
  • Purity 31%
  • Age 38 months
  • Racing Exp 0
  • Yorkshire Terrier 55%
  • 0 races
  • Gen 2
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: ATATCCAGCTTATTATTATTAATATTATTACTA
A
T
A
T
C
C
A
G
C
T
T
A
T
T
A
T
T
A
T
T
A
A
T
A
T
T
A
T
T
A
C
T
A
Genes: CNOFFFFCFFD

Composition

Yorkshire Terrier
55%
Schnauzer
18%
Pitbull terrier
9%
Corgi
9%
Beagle
9%

Current Energy

Vitality -55 points
Lunar Effect +6 points

Traits Breakdown

Body Schnauzer
Tail Pitbull terrier
Legs Corgi
Front Legs Yorkshire Terrier
Head Yorkshire Terrier
Ears Yorkshire Terrier
Snout Yorkshire Terrier
Mouth Schnauzer
Nose Yorkshire Terrier
Eyes Yorkshire Terrier
Color Beagle

Parents

No Children