Trapper Tessie Bitcoin Game Dog - Mix of Pug, Poodle, Shiba Inu, St. Bernard, Grey Wolf, Border Collie, French Bulldog, Labrador, Husky and Labrador BK

Achievements

Racer
Podium Champion
Trapper Tessie
Sup? ;-) I'm Trapper Tessie. Small yappy creatures bug me...they disturb my zen. I never met a leg I didn't want to hump. Long, leisurely walks to catch up on my pee-mail is my favorite thing on Sundays. I enjoy going to the dog park to see all my friends!
  • Purity 3%
  • Age 39 months
  • Racing Exp 91
  • Pug 18%
  • 40 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

40 races   |
  • 1 4 4
 Best Time14.97 sec
No rank  Racing *** Pts
22.5 % wins (9) Breeding *** Pts
Scheduled races 1 Total *** Pts

DNA Analysis

DNA Sequence: GAAGACGTATGACCCTACCGACCAACAGCAGAA
G
A
A
G
A
C
G
T
A
T
G
A
C
C
C
T
A
C
C
G
A
C
C
A
A
C
A
G
C
A
G
A
A
Genes: 2IEBLJ95462

Composition

Pug
18%
Poodle
9%
Shiba Inu
9%
St. Bernard
9%
Grey Wolf
9%
Border Collie
9%
French Bulldog
9%
Labrador
9%
Husky
9%
Labrador BK
9%

Current Energy

Vitality -55 points
Lunar Effect -4 points

Traits Breakdown

Body Pug
Tail Poodle
Legs Shiba Inu
Front Legs St. Bernard
Head Grey Wolf
Ears Border Collie
Snout French Bulldog
Mouth Labrador
Nose Husky
Eyes Labrador BK
Color Pug

Parents

No Children

Photos

Bitcoin doggy race podium cryptocurrency doggy racing results Litecoin canine racing results crypto doggy racing online pet race online canine race results virtual pet racing results online dog racing podium