Trapper Tessie Bitcoin Game Dog - Mix of Pug, Poodle, Shiba Inu, St. Bernard, Grey Wolf, Border Collie, French Bulldog, Labrador, Husky and Labrador BK
Trapper Tessie
  • Purity 3%
  • Age 75 months
  • Racing Exp 66
  • Pug 18%
  • Gold medal 1 Silver medal 3 Bronze medal 3
  • 26 races
  • Gen 0
Depressed & Snaillike

Achievements

Racer
Podium Champion

Bio

Sup? ;-) I'm Trapper Tessie. Small yappy creatures bug me...they disturb my zen. I never met a leg I didn't want to hump. Long, leisurely walks to catch up on my pee-mail is my favorite thing on Sundays. I enjoy going to the dog park to see all my friends!

Racing Stats

Ran 26 races
  • 1 3 3
 Best Time15.50 sec
No rank  RacingĀ *** Pts
26.9% wins (7) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: GAAGACGTATGACCCTACCGACCAACAGCAGAA
G
A
A
G
A
C
G
T
A
T
G
A
C
C
C
T
A
C
C
G
A
C
C
A
A
C
A
G
C
A
G
A
A
Genes: 2IEBLJ95462

Composition

Pug
18%
Poodle
9%
Shiba Inu
9%
St. Bernard
9%
Grey Wolf
9%
Border Collie
9%
French Bulldog
9%
Labrador
9%
Husky
9%
Labrador BK
9%

Current Energy

Vitality -55 points
Lunar Effect 0 points

Traits Breakdown

Body Pug
Tail Poodle
Legs Shiba Inu
Front Legs St. Bernard
Head Grey Wolf
Ears Border Collie
Snout French Bulldog
Mouth Labrador
Nose Husky
Eyes Labrador BK
Color Pug

Parents

No Children

Photos

virtual dog race cryptocurrency dog race podium crypto pet race photo Bitcoin doggy race podium Bitcoin doggy racing podium cryptocurrency canine race podium cryptocurrency canine racing results
Gift