Berry Brutus Crypto Dog - Mix of Dachshund, Yorkshire Terrier, Pug, Boxer, Poodle, St. Bernard, Grey Wolf and Golder Retriever

Achievements

Racer
Berry Brutus
I slept with a cat and I liked it. I love spending my days curled up in a cozy blanket with a nice, fresh bone to chew. I'm not into dog collars, unless you're into S & M. My favorite sport is catching treats my human throws!
  • Purity 4%
  • Age 41 months
  • Racing Exp 8
  • Dachshund 18%
  • 2 races
  • Gen 0
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 1 0
2 races    Best Time15.98 sec
No rank  Racing *** Coins
50.0 % wins (1) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GGATTAAACGACGAATTATGAGGACCCGAAAGA
G
G
A
T
T
A
A
A
C
G
A
C
G
A
A
T
T
A
T
G
A
G
G
A
C
C
C
G
A
A
A
G
A
Genes: AFGI2FBAL28

Composition

Dachshund
18%
Yorkshire Terrier
18%
Pug
18%
Boxer
9%
Poodle
9%
St. Bernard
9%
Grey Wolf
9%
Golder Retriever
9%

Current Energy

Vitality -50 points
Lunar Effect -6 points

Traits Breakdown

Body Dachshund
Tail Yorkshire Terrier
Legs Boxer
Front Legs Poodle
Head Pug
Ears Yorkshire Terrier
Snout St. Bernard
Mouth Dachshund
Nose Grey Wolf
Eyes Pug
Color Golder Retriever