Stanley Spark Litecoin Dog - Mix of Husky, German Shepard, Labrador BK, Rottweiler, Shiba Inu, Pitbull terrier, Schnauzer, Pug and French Bulldog
Stanley Spark
  • Purity 3%
  • Age 71 months
  • Racing Exp 80
  • Husky 18%
  • Gold medal 3 Silver medal 4 Bronze medal 3
  • 20 races
  • Gen 0
Depressed & Snaillike

Achievements

Podium Champion
Master Champion
Pro Racer

Bio

Hello, I be Stanley Spark. In the big data server, I sorta rule. I hate squeaky toys...when I finally get one to stop making that awful sound, my human buys another! I never met a leg I didn't want to hump. I'm always up for a nice long walk around the neighborhood.

Racing Stats

Ran 20 races
  • 3 4 3
 Best Time16.02 sec
Rank 59  RacingĀ *** Pts
50.0% wins (10) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: GCACACACAGTATCCACAATATCAGAATCACGA
G
C
A
C
A
C
A
C
A
G
T
A
T
C
C
A
C
A
A
T
A
T
C
A
G
A
A
T
C
A
C
G
A
Genes: 6H4EN4C7279

Composition

Husky
18%
German Shepard
18%
Labrador BK
9%
Rottweiler
9%
Shiba Inu
9%
Pitbull terrier
9%
Schnauzer
9%
Pug
9%
French Bulldog
9%

Current Energy

Vitality -33 points
Lunar Effect +10 points

Traits Breakdown

Body Labrador BK
Tail Rottweiler
Legs Husky
Front Legs Shiba Inu
Head Pitbull terrier
Ears Husky
Snout Schnauzer
Mouth German Shepard
Nose Pug
Eyes German Shepard
Color French Bulldog

Parents

No Children

Photos

crypto doggy racing podium virtual dog racing cryptocurrency pet race podium cryptocurrency dog race podium virtual doggy race Litecoin dog race online dog race virtual dog race
Gift