Wiggles Whiskers Cryptocurrency Dog - Mix of French Bulldog, St. Bernard, Border Collie, Maltese, German Shepard, Poodle, Pug, Rottweiler, Grey Wolf, Labrador and Schnauzer

Achievements

Racer
Wiggles Whiskers
I live inside of a web app in a big data center. I absolutely love long walks when I can stop and smell the bushes. I like never worrying about my dog poo. I've got people for that. My female human wears crotchless undies, but she doesn't like the ones I make for her! I'm ready to settle down and have puppies...what about you?
  • Purity 0%
  • Age 40 months
  • Racing Exp 7
  • Mixed-breed
  • 1 races
  • Gen 0
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 1 0
1 races    Best Time15.32 sec
No rank  Racing *** Coins
100.0 % wins (1) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CGATGATACACCTCAGACGAACACCCCCCAATA
C
G
A
T
G
A
T
A
C
A
C
C
T
C
A
G
A
C
G
A
A
C
A
C
C
C
C
C
C
A
A
T
A
Genes: 9BJK7I2HL5C

Composition

French Bulldog
9%
St. Bernard
9%
Border Collie
9%
Maltese
9%
German Shepard
9%
Poodle
9%
Pug
9%
Rottweiler
9%
Grey Wolf
9%
Labrador
9%
Schnauzer
9%

Current Energy

Vitality -33 points
Lunar Effect 0 points

Traits Breakdown

Body French Bulldog
Tail St. Bernard
Legs Border Collie
Front Legs Maltese
Head German Shepard
Ears Poodle
Snout Pug
Mouth Rottweiler
Nose Grey Wolf
Eyes Labrador
Color Schnauzer