Shiner Star Bitcoin Dog - Mix of Pug, Labrador, Border Collie, St. Bernard, Husky, Grey Wolf, Poodle, Shiba Inu, Labrador BK and French Bulldog
Shiner Star
  • Purity 1%
  • Age 36 months
  • Racing Exp 7
  • Pug 18%
  • Gold medal 0 Silver medal 1 Bronze medal 0
  • 1 races
  • Gen 0
Depressed & Snaillike

Achievements

Racer

Bio

Hello there, my name is Shiner Star. I was born in the web cloud. My 'G' spot is under my chin...scratch me there and I'll growl softly. I enjoy mixing it up once in a while by visiting different dog parks. I love car rides when I can stick my head out the window.

Racing Stats

Ran 1 races
  • 0 1 0
 Best Time15.42 sec
Rank 44  RacingĀ *** Pts
100.0 % wins (1) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: CCAGAATACTGAACACCCGACGTAGAAGCACGA
C
C
A
G
A
A
T
A
C
T
G
A
A
C
A
C
C
C
G
A
C
G
T
A
G
A
A
G
C
A
C
G
A
Genes: 52JB4LIE269

Composition

Pug
18%
Labrador
9%
Border Collie
9%
St. Bernard
9%
Husky
9%
Grey Wolf
9%
Poodle
9%
Shiba Inu
9%
Labrador BK
9%
French Bulldog
9%

Current Energy

Vitality -19 points
Lunar Effect -4 points

Traits Breakdown

Body Labrador
Tail Pug
Legs Border Collie
Front Legs St. Bernard
Head Husky
Ears Grey Wolf
Snout Poodle
Mouth Shiba Inu
Nose Pug
Eyes Labrador BK
Color French Bulldog

Parents

No Children

Photos

crypto dog race photo Bitcoin doggy race podium virtual canine race online pet race Litecoin dog race photo Litecoin doggy race results Bitcoin pet racing online pet racing
Gift