Shiner Star Bitcoin Dog - Mix of Pug, Labrador, Border Collie, St. Bernard, Husky, Grey Wolf, Poodle, Shiba Inu, Labrador BK and French Bulldog

Achievements

Racer
Podium Champion
Shiner Star
Hello there, my name is Shiner Star. I was born in the web cloud. My 'G' spot is under my chin...scratch me there and I'll growl softly. I enjoy mixing it up once in a while by visiting different dog parks. I love car rides when I can stick my head out the window.
  • Purity 1%
  • Age 39 months
  • Racing Exp 74
  • Pug 18%
  • 21 races
  • Gen 0
Share it to make him Happy!
Sad & Tardy
Energy: ▂▃▅▆▇

Racing Stats

21 races   |
  • 3 2 4
 Best Time14.17 sec
No rank  Racing *** Pts
42.9 % wins (9) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: CCAGAATACTGAACACCCGACGTAGAAGCACGA
C
C
A
G
A
A
T
A
C
T
G
A
A
C
A
C
C
C
G
A
C
G
T
A
G
A
A
G
C
A
C
G
A
Genes: 52JB4LIE269

Composition

Pug
18%
Labrador
9%
Border Collie
9%
St. Bernard
9%
Husky
9%
Grey Wolf
9%
Poodle
9%
Shiba Inu
9%
Labrador BK
9%
French Bulldog
9%

Current Energy

Vitality -19 points
Lunar Effect -4 points

Traits Breakdown

Body Labrador
Tail Pug
Legs Border Collie
Front Legs St. Bernard
Head Husky
Ears Grey Wolf
Snout Poodle
Mouth Shiba Inu
Nose Pug
Eyes Labrador BK
Color French Bulldog