Sheba Snoopy Bitcoin Dog - Mix of Border Collie, German Shepard, Pug, Labrador BK, Rottweiler, Boxer and French Bulldog

Achievements

None
Sheba Snoopy
I have an ongoing battle with the vacuum cleaner. It's loud and it steals all the food crumbs I was saving for later! I slept with a cat and I liked it. I absolutely love long walks when I can stop and smell the bushes. My human says I'm loyal, intelligent, devoted and affectionate.
  • Purity 12%
  • Age 10 months
  • Racing Exp 0
  • Border Collie 36%
  • 0 races
  • Gen 2
Make him happy share it to your friend*
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TACGAAGCATACTACCACAACCGATCATACTCA
T
A
C
G
A
A
G
C
A
T
A
C
T
A
C
C
A
C
A
A
C
C
G
A
T
C
A
T
A
C
T
C
A
Genes: J26JJHG97J7

Composition

Border Collie
36%
German Shepard
18%
Pug
9%
Labrador BK
9%
Rottweiler
9%
Boxer
9%
French Bulldog
9%

Current Energy

Vitality +7 points
Lunar Effect 0 points

Traits Breakdown

Body Border Collie
Tail Pug
Legs Labrador BK
Front Legs Border Collie
Head Border Collie
Ears Rottweiler
Snout Boxer
Mouth French Bulldog
Nose German Shepard
Eyes Border Collie
Color German Shepard