Kramer Kelsey Bitcoin Game Dog - Mix of Pug, Border Collie, Poodle, Shiba Inu, St. Bernard, Husky, Grey Wolf, Labrador BK, Labrador and French Bulldog

Achievements

Podium Champion
Pro Racer
Master Champion
Kramer Kelsey
I'm Kramer Kelsey. How goes it? Air Bud is definitely my favorite movie. What a role model! I love fetching anything my human throws! I dislike anyone messing with my toys. They are MY toys. But I'd be willing to share with the right partner ;) I never met a leg I didn't want to hump.
  • Purity 1%
  • Age 39 months
  • Racing Exp 88
  • Pug 18%
  • 24 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

24 races   |
  • 2 5 4
 Best Time15.10 sec
Rank 52  Racing *** Pts
45.8 % wins (11) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: TACGACGTATGAGAAACAGAACCCGCACCACGA
T
A
C
G
A
C
G
T
A
T
G
A
G
A
A
A
C
A
G
A
A
C
C
C
G
C
A
C
C
A
C
G
A
Genes: JIEB242L659

Composition

Pug
18%
Border Collie
9%
Poodle
9%
Shiba Inu
9%
St. Bernard
9%
Husky
9%
Grey Wolf
9%
Labrador BK
9%
Labrador
9%
French Bulldog
9%

Current Energy

Vitality -44 points
Lunar Effect -4 points

Traits Breakdown

Body Border Collie
Tail Poodle
Legs Shiba Inu
Front Legs St. Bernard
Head Pug
Ears Husky
Snout Pug
Mouth Grey Wolf
Nose Labrador BK
Eyes Labrador
Color French Bulldog

Parents

No Children

Photos

Litecoin doggy racing cryptocurrency pet racing virtual canine racing virtual pet racing podium online dog racing virtual doggy race podium crypto doggy racing online canine race