Mabel Maddie Bitcoin Dog - Mix of Pitbull terrier, Boxer, Schnauzer, Grey Wolf, Rottweiler and Yorkshire Terrier

Achievements

Racer
Podium Champion
Master Champion
Mabel Maddie
I'm Mabel Maddie and I'd like to show you a trick or two. My humans say I bark too much, but I have a lot to say! I enjoy staying active, and running circles around puppies and young children. My human is my best friend, looking for someone who is okay with that.
  • Purity 14%
  • Age 42 months
  • Racing Exp 121
  • Pitbull terrier 27%
  • 39 races
  • Gen 0
Make him happy share it to your friend*
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

39 races   |
  • 2 8 4
 Best Time14.32 sec
No rank  Racing *** Coins
35.9 % wins (14) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TCCAACAACATAATATCCCCCAACTCCCACTTA
T
C
C
A
A
C
A
A
C
A
T
A
A
T
A
T
C
C
C
C
C
A
A
C
T
C
C
C
A
C
T
T
A
Genes: NGGCCNLGNHF

Composition

Pitbull terrier
27%
Boxer
27%
Schnauzer
18%
Grey Wolf
9%
Rottweiler
9%
Yorkshire Terrier
9%

Current Energy

Vitality -55 points
Lunar Effect -10 points

Traits Breakdown

Body Pitbull terrier
Tail Boxer
Legs Boxer
Front Legs Schnauzer
Head Schnauzer
Ears Pitbull terrier
Snout Grey Wolf
Mouth Boxer
Nose Pitbull terrier
Eyes Rottweiler
Color Yorkshire Terrier