Buster-Brown Blake Crypto Dog - Mix of Pug, Poodle, St. Bernard, Husky, French Bulldog, Shiba Inu, Labrador, Labrador BK, Border Collie and Grey Wolf

Achievements

Racer
Buster-Brown Blake
The internet's my home. I'm an avid runner! Outside, inside, all over the place! I just want to run! I never knew my father. You know the worst? Watching my humans 'get it on' when I've got no one. Ultimate Frisbee is my favorite sport. I haven't really mastered the throwing part yet, but I have the catching part down!
  • Purity 1%
  • Age 41 months
  • Racing Exp 17
  • Pug 18%
  • 6 races
  • Gen 0
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 1 1
6 races    Best Time16.53 sec
Rank 86  Racing *** Coins
33.3 % wins (2) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GACGAATGAACACGAGTACCAGCAGAATACCCC
G
A
C
G
A
A
T
G
A
A
C
A
C
G
A
G
T
A
C
C
A
G
C
A
G
A
A
T
A
C
C
C
C
Genes: I2B49E562JL

Composition

Pug
18%
Poodle
9%
St. Bernard
9%
Husky
9%
French Bulldog
9%
Shiba Inu
9%
Labrador
9%
Labrador BK
9%
Border Collie
9%
Grey Wolf
9%

Current Energy

Vitality -28 points
Lunar Effect -8 points

Traits Breakdown

Body Poodle
Tail Pug
Legs St. Bernard
Front Legs Husky
Head French Bulldog
Ears Shiba Inu
Snout Labrador
Mouth Labrador BK
Nose Pug
Eyes Border Collie
Color Grey Wolf