Buster-Brown Blake Crypto Dog - Mix of Pug, Poodle, St. Bernard, Husky, French Bulldog, Shiba Inu, Labrador, Labrador BK, Border Collie and Grey Wolf
Buster-Brown Blake
  • Purity 1%
  • Age 37 months
  • Racing Exp 12
  • Pug 18%
  • Gold medal 0 Silver medal 0 Bronze medal 1
  • 7 races
  • Gen 0
Depressed & Snaillike

Achievements

Racer

Bio

The internet's my home. I'm an avid runner! Outside, inside, all over the place! I just want to run! I never knew my father. You know the worst? Watching my humans 'get it on' when I've got no one. Ultimate Frisbee is my favorite sport. I haven't really mastered the throwing part yet, but I have the catching part down!

Racing Stats

Ran 7 races
  • 0 0 1
 Best Time16.45 sec
Rank 87  RacingĀ *** Pts
14.3 % wins (1) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: GACGAATGAACACGAGTACCAGCAGAATACCCC
G
A
C
G
A
A
T
G
A
A
C
A
C
G
A
G
T
A
C
C
A
G
C
A
G
A
A
T
A
C
C
C
C
Genes: I2B49E562JL

Composition

Pug
18%
Poodle
9%
St. Bernard
9%
Husky
9%
French Bulldog
9%
Shiba Inu
9%
Labrador
9%
Labrador BK
9%
Border Collie
9%
Grey Wolf
9%

Current Energy

Vitality -28 points
Lunar Effect -8 points

Traits Breakdown

Body Poodle
Tail Pug
Legs St. Bernard
Front Legs Husky
Head French Bulldog
Ears Shiba Inu
Snout Labrador
Mouth Labrador BK
Nose Pug
Eyes Border Collie
Color Grey Wolf

Parents

No Children

Photos

cryptocurrency canine race online canine racing virtual pet racing online pet race results Litecoin dog race results
Gift