Mollie Meadow Digital Cryptocurrency Dog - Mix of Border Collie, Dachshund, Schnauzer, Labrador, Husky, Labrador BK and German Shepard

Achievements

None
Mollie Meadow
I cry whenever I hear an ambulance siren! My favorite place to sleep is under the covers between my humans. I hate it when I am not the center of attention. My bark alone scares birds out of my yard.
  • Purity 18%
  • Age 41 months
  • Racing Exp 0
  • Border Collie 45%
  • 0 races
  • Gen 8
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TACTACGGATACATACCAACATACGCATCATAC
T
A
C
T
A
C
G
G
A
T
A
C
A
T
A
C
C
A
A
C
A
T
A
C
G
C
A
T
C
A
T
A
C
Genes: JJAJC54J67J

Composition

Border Collie
45%
Dachshund
9%
Schnauzer
9%
Labrador
9%
Husky
9%
Labrador BK
9%
German Shepard
9%

Current Energy

Vitality -34 points
Lunar Effect -4 points

Traits Breakdown

Body Border Collie
Tail Border Collie
Legs Dachshund
Front Legs Border Collie
Head Schnauzer
Ears Labrador
Snout Husky
Mouth Border Collie
Nose Labrador BK
Eyes German Shepard
Color Border Collie