Tasha Toby Bitcoin Dog - Mix of Yorkshire Terrier, Schnauzer, Beagle, Border Collie, Pug and Grey Wolf

Achievements

Racer
Tasha Toby
In my digital world, cats aren't the only ones who hack. I'll eat my vomit and yours too. I enjoy trying to be friends with the neighbor's cats. They still run away from me but they'll grow to love me one day! You know the worst? Watching my humans 'get it on' and I have to lick myself.
  • Purity 21%
  • Age 38 months
  • Racing Exp 7
  • Yorkshire Terrier 45%
  • 1 races
  • Gen 0
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

1 races   |
  • 0 1 0
 Best Time16.10 sec
No rank  Racing *** Pts
100.0 % wins (1) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: ATACTATACGAATTATTATTAATATTATTACCC
A
T
A
C
T
A
T
A
C
G
A
A
T
T
A
T
T
A
T
T
A
A
T
A
T
T
A
T
T
A
C
C
C
Genes: CDJ2FFFCFFL

Composition

Yorkshire Terrier
45%
Schnauzer
18%
Beagle
9%
Border Collie
9%
Pug
9%
Grey Wolf
9%

Current Energy

Vitality -50 points
Lunar Effect +2 points

Traits Breakdown

Body Schnauzer
Tail Beagle
Legs Border Collie
Front Legs Pug
Head Yorkshire Terrier
Ears Yorkshire Terrier
Snout Yorkshire Terrier
Mouth Schnauzer
Nose Yorkshire Terrier
Eyes Yorkshire Terrier
Color Grey Wolf

Parents

Children

Photos

Bitcoin pet racing podium