Samson Sally Crypto Dog - Mix of Boxer, Pug, Labrador, Golder Retriever, Rottweiler, St. Bernard, Labrador BK and Dachshund

Achievements

Racer
Samson Sally
Hola! My name is Samson Sally. Chasing that damn Nyan Cat out into some web traffic on the information superhighway in #1 on my bucket list. Walks on the beach are nice, but my favorite thing in the world is go shopping to PetCo for a new bone. I'd like to help you shed your coat, baby.
  • Purity 8%
  • Age 39 months
  • Racing Exp 15
  • Boxer 27%
  • 3 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

3 races   |
  • 1 0 1
 Best Time17.33 sec
No rank  Racing *** Pts
66.7 % wins (2) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: CCAAGAAACCACAACGAAGAAAACTGAGCAGGA
C
C
A
A
G
A
A
A
C
C
A
C
A
A
C
G
A
A
G
A
A
A
A
C
T
G
A
G
C
A
G
G
A
Genes: 58GHG22GB6A

Composition

Boxer
27%
Pug
18%
Labrador
9%
Golder Retriever
9%
Rottweiler
9%
St. Bernard
9%
Labrador BK
9%
Dachshund
9%

Current Energy

Vitality -33 points
Lunar Effect 0 points

Traits Breakdown

Body Labrador
Tail Golder Retriever
Legs Boxer
Front Legs Rottweiler
Head Boxer
Ears Pug
Snout Pug
Mouth Boxer
Nose St. Bernard
Eyes Labrador BK
Color Dachshund