Brook Bosley Bitcoin Dog - Mix of Golder Retriever, Grey Wolf, Yorkshire Terrier, Shiba Inu, Labrador, Poodle, Pug, Maltese, Beagle, French Bulldog and Rottweiler

Achievements

None
Brook Bosley
How YOU doin'? Brook Bosley here. Currently, I live on the information superhighway. I live life by my favorite quote "Every dog has it's day", but every day is my day! I want to find someone I can wrestle with and nibble on. Does that sound like you?
  • Purity 0%
  • Age 43 months
  • Racing Exp 0
  • Mixed-breed
  • 0 races
  • Gen 0
Make him happy share it to your friend*
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: AGACCCTTAGTACCAGACGAAACCCTACGACAC
A
G
A
C
C
C
T
T
A
G
T
A
C
C
A
G
A
C
G
A
A
A
C
C
C
T
A
C
G
A
C
A
C
Genes: 8LFE5I2KD9H

Composition

Golder Retriever
9%
Grey Wolf
9%
Yorkshire Terrier
9%
Shiba Inu
9%
Labrador
9%
Poodle
9%
Pug
9%
Maltese
9%
Beagle
9%
French Bulldog
9%
Rottweiler
9%

Current Energy

Vitality -42 points
Lunar Effect -4 points

Traits Breakdown

Body Golder Retriever
Tail Grey Wolf
Legs Yorkshire Terrier
Front Legs Shiba Inu
Head Labrador
Ears Poodle
Snout Pug
Mouth Maltese
Nose Beagle
Eyes French Bulldog
Color Rottweiler