Jasper Jackpot Virtual Crypto Game Dog - Mix of Shiba Inu, St. Bernard, Husky, German Shepard, Beagle, Labrador and Dachshund

Achievements

None
Jasper Jackpot
A-yo...Call me Jasper Jackpot. I'm a gourmand...my favorite dish is that dry food that makes it's own gravy! I've always wanted to be in commercials and be treated as the star I am! I love connecting with my friends via pee-mail. I'm looking for a good Tug-O-War partner.
  • Purity 10%
  • Age 54 days
  • Racing Exp 0
  • Shiba Inu 36%
  • 0 races
  • Gen 1
Share it to make him Happy!
Sad & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GTATGAACAGTATCACTAGTACCAGTATGAGGA
G
T
A
T
G
A
A
C
A
G
T
A
T
C
A
C
T
A
G
T
A
C
C
A
G
T
A
T
G
A
G
G
A
Genes: EB4E7DE5EBA

Composition

Shiba Inu
36%
St. Bernard
18%
Husky
9%
German Shepard
9%
Beagle
9%
Labrador
9%
Dachshund
9%

Current Energy

Vitality +13 points
Lunar Effect +10 points

Traits Breakdown

Body Shiba Inu
Tail St. Bernard
Legs Husky
Front Legs Shiba Inu
Head German Shepard
Ears Beagle
Snout Shiba Inu
Mouth Labrador
Nose Shiba Inu
Eyes St. Bernard
Color Dachshund

Parents

No Children