Bumper Bimmer Litecoin Game Dog - Mix of Husky, Pug, Grey Wolf, Golder Retriever, Shiba Inu, Pitbull terrier, Dachshund and Boxer

Achievements

None
Bumper Bimmer
How you doin? ;) Bumper Bimmer here. Baby, I'm made from the same stuff as dreams. Chasing anything that will run is so much fun, I could do that all day. My human says I'm loyal, intelligent, devoted and affectionate. Once I caught a seagull, but it scared me so I let it go.
  • Purity 8%
  • Age 3 months
  • Racing Exp 0
  • Husky 27%
  • 0 races
  • Gen 3
Make him happy share it to your friend*
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: ACACCCACAAGAGAAGTATCCGGAGAAAACACA
A
C
A
C
C
C
A
C
A
A
G
A
G
A
A
G
T
A
T
C
C
G
G
A
G
A
A
A
A
C
A
C
A
Genes: 4L482ENA2G4

Composition

Husky
27%
Pug
18%
Grey Wolf
9%
Golder Retriever
9%
Shiba Inu
9%
Pitbull terrier
9%
Dachshund
9%
Boxer
9%

Current Energy

Vitality -17 points
Lunar Effect +4 points

Traits Breakdown

Body Husky
Tail Grey Wolf
Legs Husky
Front Legs Golder Retriever
Head Pug
Ears Shiba Inu
Snout Pitbull terrier
Mouth Dachshund
Nose Pug
Eyes Boxer
Color Husky