Austin Astro Crypto Game Dog - Mix of Border Collie, Rottweiler, French Bulldog, Pitbull terrier, Labrador, Maltese, Boxer and Yorkshire Terrier

Achievements

Racer
Podium Champion
Austin Astro
My name is Austin Astro and I do tricks. Ultimate Frisbee is my favorite sport. I haven't really mastered the throwing part yet, but I have the catching part down! I like to work out by digging fresh holes in landscaped yards. I hate it when I am not the center of attention.
  • Purity 9%
  • Age 39 months
  • Racing Exp 47
  • Border Collie 27%
  • 13 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

13 races   |
  • 1 2 3
 Best Time15.83 sec
No rank  Racing *** Pts
46.2 % wins (6) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: CACTACCGATCCCCAACCAACTTATACTACCAC
C
A
C
T
A
C
C
G
A
T
C
C
C
C
A
A
C
C
A
A
C
T
T
A
T
A
C
T
A
C
C
A
C
Genes: HJ9N5KGFJJH

Composition

Border Collie
27%
Rottweiler
18%
French Bulldog
9%
Pitbull terrier
9%
Labrador
9%
Maltese
9%
Boxer
9%
Yorkshire Terrier
9%

Current Energy

Vitality -35 points
Lunar Effect 0 points

Traits Breakdown

Body Rottweiler
Tail Border Collie
Legs French Bulldog
Front Legs Pitbull terrier
Head Labrador
Ears Maltese
Snout Boxer
Mouth Yorkshire Terrier
Nose Border Collie
Eyes Border Collie
Color Rottweiler

Parents

No Children

Photos

virtual canine race podium online doggy race photo virtual dog race Litecoin pet racing photo Litecoin dog race Litecoin dog race podium Bitcoin dog race Bitcoin canine racing