Austin Astro Crypto Game Dog - Mix of Border Collie, Rottweiler, French Bulldog, Pitbull terrier, Labrador, Maltese, Boxer and Yorkshire Terrier
Austin Astro
  • Purity 9%
  • Age 75 months
  • Racing Exp 47
  • Border Collie 27%
  • Gold medal 1 Silver medal 2 Bronze medal 3
  • 13 races
  • Gen 0
Ecstatic & Fast

Achievements

Racer
Podium Champion

Bio

My name is Austin Astro and I do tricks. Ultimate Frisbee is my favorite sport. I haven't really mastered the throwing part yet, but I have the catching part down! I like to work out by digging fresh holes in landscaped yards. I hate it when I am not the center of attention.

Racing Stats

Ran 13 races
  • 1 2 3
 Best Time15.83 sec
No rank  RacingĀ *** Pts
46.2% wins (6) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: CACTACCGATCCCCAACCAACTTATACTACCAC
C
A
C
T
A
C
C
G
A
T
C
C
C
C
A
A
C
C
A
A
C
T
T
A
T
A
C
T
A
C
C
A
C
Genes: HJ9N5KGFJJH

Composition

Border Collie
27%
Rottweiler
18%
French Bulldog
9%
Pitbull terrier
9%
Labrador
9%
Maltese
9%
Boxer
9%
Yorkshire Terrier
9%

Current Energy

Vitality -35 points
Lunar Effect 0 points

Traits Breakdown

Body Rottweiler
Tail Border Collie
Legs French Bulldog
Front Legs Pitbull terrier
Head Labrador
Ears Maltese
Snout Boxer
Mouth Yorkshire Terrier
Nose Border Collie
Eyes Border Collie
Color Rottweiler

Parents

No Children

Photos

online doggy racing results online pet racing photo virtual canine race Litecoin dog racing virtual dog racing podium cryptocurrency canine race podium virtual doggy race crypto dog race
Gift