Ram R2D2 Bitcoin Dog - Mix of Grey Wolf, St. Bernard, Labrador, Shiba Inu, Labrador BK, Border Collie, Dachshund, Maltese and Rottweiler

Achievements

None
Ram R2D2
I enjoy staying active, and running circles around puppies and young children. Eat, sleep, poop. Honey, I've got it made. If I can't reach it to clean it myself, it doesn't need cleaning! I'm sick of having my nails clipped, those are to help me dig! Fun-loving and playful only need apply.
  • Purity 3%
  • Age 3 months
  • Racing Exp 0
  • Grey Wolf 18%
  • 0 races
  • Gen 1
Make him happy share it to your friend*
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CCCCCAGTACCCTGAGCATACGGATGAACCCAC
C
C
C
C
C
A
G
T
A
C
C
C
T
G
A
G
C
A
T
A
C
G
G
A
T
G
A
A
C
C
C
A
C
Genes: L5ELB6JABKH

Composition

Grey Wolf
18%
St. Bernard
18%
Labrador
9%
Shiba Inu
9%
Labrador BK
9%
Border Collie
9%
Dachshund
9%
Maltese
9%
Rottweiler
9%

Current Energy

Vitality -15 points
Lunar Effect -6 points

Traits Breakdown

Body Grey Wolf
Tail Labrador
Legs Shiba Inu
Front Legs Grey Wolf
Head St. Bernard
Ears Labrador BK
Snout Border Collie
Mouth Dachshund
Nose St. Bernard
Eyes Maltese
Color Rottweiler