Brooke Blake Crypto Dog - Mix of Corgi, Labrador BK, Pug, Shiba Inu, Maltese, Rottweiler, Husky, Pitbull terrier, German Shepard and French Bulldog

Achievements

None
Brooke Blake
Who's a good dog? Hopefully you! Brooke Blake here. I've been known to take mega bytes when playing ruff. I live life by my favorite quote "Every dog has it's day", but every day is my day! I pee when I'm excited. I love hiding my human's shoes. I have a pretty nice collection of old, stinky sneakers.
  • Purity 1%
  • Age 3 months
  • Racing Exp 0
  • Corgi 18%
  • 0 races
  • Gen 1
Make him happy share it to your friend*
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GCAGAAGTAAGCACCCACAGCACATCCTCACGA
G
C
A
G
A
A
G
T
A
A
G
C
A
C
C
C
A
C
A
G
C
A
C
A
T
C
C
T
C
A
C
G
A
Genes: 62EOKHO4N79

Composition

Corgi
18%
Labrador BK
9%
Pug
9%
Shiba Inu
9%
Maltese
9%
Rottweiler
9%
Husky
9%
Pitbull terrier
9%
German Shepard
9%
French Bulldog
9%

Current Energy

Vitality -20 points
Lunar Effect +4 points

Traits Breakdown

Body Labrador BK
Tail Pug
Legs Shiba Inu
Front Legs Corgi
Head Maltese
Ears Rottweiler
Snout Corgi
Mouth Husky
Nose Pitbull terrier
Eyes German Shepard
Color French Bulldog